Pmal p2x

A prokaryotic expression system with vector pET30a and E. coli BL21(DE3) (Novagen, Darmstadt, Germany) was used to express recombinant full-length VgrS, truncated VgrS without the input domain, and VgrR. A C-terminal His₆ epitope was fused to these proteins. The vector pMal-p2X (NEB, New England, UK) was used to express the truncated VgrS (MBP-VgrS) protein. His₆-tagged proteins were expressed and purified by affinity chromatography using Ni-NTA agarose beads (Novagen) according to the manufacturer’s instructions.
Inverted membrane vesicles (IMVs) containing full-length VgrS were prepared according to a published method [48 (link), 51 (link)]. In brief, bacteria were homogenized by sonication, and the membrane containing VgrS was collected by ultracentrifugation at 200,000 × g for 60 min at 4°C. The membranes were washed in high-salt buffer (20 mM sodium phosphate, pH 7.0, 2 M KCl, 10% glycerol, 5 mM EDTA, 5 mM DTT, 1 mM PMSF). IMVs were pelleted by ultracentrifugation (410,000 × g; 20 min; 4°C), resuspended in 0.2 mL storage buffer (20 mM Tris-HCl, pH 7.5, 10% glycerol) and used for in vitro phosphorylation assays.

The Vpu gene (according to the sequence in [1] (link)) was cloned in the pMal-p2x commercial plasmid (New England BioLabs, Ipswich, MA) that carries a p-lac promotor and antibiotic resistance. The plasmid is designed to over express a fusion-taged maltose binding protein (MBP) on the N-terminus of the protein of interest, which in the current study is a codon optimized gene coding for Vpu of HIV-1 [43] (link). The chimera further carries a His-Tag at the C-terminus. This chimera construct was used throughout the study.
Two main strains of Escherichia coli K12 were used: DH10B and LB650. DH10B bacteria cells were purchased from Invitrogen (distributed by Rhenium, Modi'in Israel). LB650 bacteria were a kind gift of Prof. K. Jung (Ludwig-Maximilians Universität München) and Prof. G.A. Berkowitz (University of Connecticut). The bacteria carry deletions in genes connected to potassium uptake [39] .

Codon‐optimized DNA sequence for expression in E. coli of the human TMBIM5 protein was synthesized from PCR fragments by GeneArt (Life Technologies) and subsequently cloned into the bacterial overexpression vector pMALp2x (NEB). The recombinant TMBIM5 protein expression was performed in BL21(DE3) E. coli. The bacteria were propagated in a TB medium. Protein expression was induced with 0.5 mM IPTG and was carried out at 37°C for 4 h in an orbital shaker. Bacterial cells were harvested at 3,000 g for 20 min, washed in 200 mM NaCl, 5% glycerol, 1 mM EDTA, 20 mM HEPES‐KOH pH 7.4, and stored at −20°C. Bacterial pellets were resuspended in buffer (200 mM NaCl, 5% glycerol, 1 mM EDTA, 1 mM DTT, 20 mM HEPES‐KOH pH7.4), which was supplemented with protease inhibitor cocktail (Roche) and lysed in an Emulsiflex. The obtained cell lysate was supplemented with 0.05% DDM and spun down at 180,000 g at 4°C for 20 min. The supernatant was applied onto MBPTrap affinity column (Cytiva; Cat# 28918780) and the bound fraction was subsequently eluted with 10 mM maltose. Protein‐containing fractions were subjected to Factor Xa digest (NEB). Resulting mixture of untagged TMBIM5 and free MBP‐tag was separated on HiLoad Superdex 16/600 75 pg column equilibrated in 120 mM N‐methyl‐D‐glutamate (NMDG), 1 mM DTT, 0.05% DDM, 10 m MOPS‐KOH pH 7.4.

All primer sequences are described in S1 Table. The H2B gene (TcCLB.511635.10), BDF2 (TcCLB.506553.20) and H2A.Z (TcCLB.511323.40) from T. cruzi (CL Brener strain) were amplified using the following pair of primers (all containing Eco RI and Hind III cleavage sites): H2Bc_F and H2Bc_R; HA_BDF2_Forward and BDF2_Reverse, and H2A.Z_Forward and H2A.Z_Reverse. BDF2 was amplified by fusion with HA from the vector pDEST17, which was kindly provided by Dr. Esteban Serra. The PCR products were purified and cloned first at pJET1/2blunt (Invitrogen), and after SANGER sequencing confirmation, the insert was subcloned either at pET28(a)+ (Novagen) (for H2B and BDF2) or at pMAL-p2x (NEB) (for H2A.Z). Plasmids were transfected into E. coli DH5α and/or at BL21 DE3 for recombinant expression as described previously [36 (link)]. Briefly, E. coli BL21 DE3 transformed either with pET28a (+)-H2B.V [36 (link)], pET28a(+)-H2B, pET28a(+)-BDF2 or pMAL-p2x-H2A.Z were inoculated in LB base medium (tryptone 1%, NaCl 1%, yeast extract 0.5%, pH 7) containing kanamycin 50 μg/mL at 37°C for up to 18 h, and recombinant expression was induced with 1 mM IPTG. H2B, H2B.V and BDF2 (His-tag) and H2A.Z (fused with a maltose-binding protein -MBP) purification were performed by affinity chromatography using Ni-NTA agarose (Qiagen) and amylose resin (NEB), respectively, according to the manufacturer’s recommendations.

The full-length NucT encoding sequence was amplified by PCR using Helicobacter pylori 26695 purified genomic DNA as a template. The resulting PCR product was sub-cloned in pMal-p2X plasmid (New England Biolabs) digested by XmnI-XbaI. To delete the signal peptide spanning the 23 first amino-acids of NucT protein, the previous plasmid was amplified by PCR with overlapping primers (forward primer: 5’–AAAAACAGCTTATTTGTCTTACCTTATG– 3’ and reverse primer: 5’–GTAAGACAAATAAGCTGTTTTTTGAAATCCTTCCCTCGATC– 3’) generating pMal-p2X-NucT-24-180. The initial Factor Xa recognition site encoding sequence of pMal-p2X-NucT-24-180 was replaced by a TEV protease recognition site encoding sequence and a linker by PCR with overlapping primers (forward primer: 5’–GAATTCAAAAACAGCTTATTTGTCTTACCTTATG– 3’ and reverse primer: 5’–CAAATAAGCTGTTTTTGAATTCTGAAATGCCCTGAAAATACAGGTTTTCCCCGAGGTTGTTGTTATTG– 3’) generating the pMal-p2X-TEV-EF-NucT-24-180 plasmid. Finally, site directed mutagenesis of the His124 residue in Asn was conducted by PCR with overlapping primers (forward primer: 5’–AACCAAAAAGTAGCGATCATTG– 3’ and reverse primer: 5’–GATCGCTACTTTTTGGTTCATGATGCCGTAATAATTCC– 3’). All PCR were performed with Phusion DNA polymerase (NEB).