Taqman fastadvance pcr master mix

Manufactured by Thermo Fisher Scientific

TaqMan FastAdvance PCR master mix is a ready-to-use solution for real-time PCR amplification. It contains all the necessary components for efficient DNA amplification and detection, including a DNA polymerase, dNTPs, and a proprietary buffer system.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using taqman fastadvance pcr master mix

Quantifying Immune-Related Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

OAS1 (Hs00973637_m1), MX1 (Hs00895608_m1), LY6E (Hs00158942_m1), STAT1 (Hs01013996_m1), CCL2 (Hs00234140_m1), CXCL10 (Hs00171042_m1), ADAR (Hs00241666_m1), TNFα (Hs00174128_m1), and pri-miR-146a (Hs033303259_pri) levels were analyzed by TaqMan mRNA assay primers (Applied Biosystems, Foster City, CA, USA). mRNA qRT-PCR was performed as a duplex with 18S rRNA assayed as the normalizer. mRNA was transcribed to cDNA using the TaqMan High-Capacity cDNA Reverse Transcription Kit followed by quantitative (q)PCR using TaqMan Fast Advance PCR Master Mix (Applied Biosystems). miR-146a (000468; Catalogue # 4427975) was analyzed by miRNA qRT-PCR using the TaqMan MicroRNA Reverse Transcription Kit, TaqMan Fast Advance PCR Master Mix, and TaqMan MicroRNA primers (Applied Biosystems). All reactions were analyzed using StepOne Real-Time PCR System (Applied Biosystems).

Dominguez-Gutierrez P.R., Ceribelli A., Satoh M., Sobel E.S., Reeves W.H, & Chan E.K. (2014). Elevated signal transducers and activators of transcription 1 correlates with increased C-C motif chemokine ligand 2 and C-X-C motif chemokine 10 levels in peripheral blood of patients with systemic lupus erythematosus. Arthritis Research & Therapy, 16(1), R20.

+ Open protocol

+ Expand

Quantitative PCR for HCMV Genome Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from approximately 1-mm² sections of mouse spleen or liver using the DNAzol kit (Life Technologies). HCMV genomes were analyzed using quantitative PCR (TaqMan) performed on 1 µg of total DNA and using TaqMan FastAdvance PCR master mix (Applied Biosystems) according to the manufacturer’s instructions. Primers and a probe recognizing HCMV UL141 were used to quantify HCMV genomes (probe, CGAGGGAGAGCAAGTT; forward primer, 5′-GATGTGGGCCGAGAATTATGA; reverse primer, 5′-ATGGGCCAGGAGTGTGTCA). The probe contains a 5′ FAM (6-carboxyfluorescein) reporter molecule and a 3′ quencher molecule (Applied Biosystems). The reaction was initiated using TaqMan Fast Advanced master mix (Applied Biosystems) activated at 95°C for 10 min followed by 40 cycles (1 cycle consists of 15 s at 95°C and 1 min at 60°C) using a StepOnePlus TaqMan thermocycler. Results were analyzed using ABI StepOne software. Data were analyzed using the statistical program GraphPad Prism 5. Statistical significance was determined using two-way analysis of variance, followed by Bonferroni’s posttest correction. A P value of <0.05 or lower was considered significant.

Vashee S., Stockwell T.B., Alperovich N., Denisova E.A., Gibson D.G., Cady K.C., Miller K., Kannan K., Malouli D., Crawford L.B., Voorhies A.A., Bruening E., Caposio P, & Früh K. (2017). Cloning, Assembly, and Modification of the Primary Human Cytomegalovirus Isolate Toledo by Yeast-Based Transformation-Associated Recombination. mSphere, 2(5), e00331-17.

+ Open protocol

+ Expand

Quantitative Analysis of Inflammatory Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was collected from the cell pellet and extracted with TRI reagent (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. CCL2, CCL3, CCL4, CCL22, IL-1Rα, IL-6, IL-8, S100a9, and GAPDH levels were analyzed by qRT-PCR. mRNA qRT-PCR was performed using the TaqMan High-Capacity cDNA Reverse Transcription Kit, TaqMan Fast Advance PCR Master Mix, and TaqMan mRNA assay primers (Applied Biosystems, ?city state?). All reactions were analyzed using 7900HT Fast Real-Time PCR System (Applied Biosystems). Relative expression of mRNA were determined by the ΔΔC_T method where the cycle threshold (C_T) values, corresponding to the PCR cycle number at which fluorescence emission reaches a threshold above baseline emission, were determined for the mRNA expression relative to untreated controls. Analyses were performed using JMP pro version 10 (SAS, Cary, NC). P-test was used to evaluate significance. P values less than 0.05 were considered significant.

Kusmartsev S., Dominguez-Gutierrez P.R., Canales B.K., Bird V.G., Vieweg J, & Khan S.R. (2015). CALCIUM OXALATE STONE FRAGMENT AND CRYSTAL PHAGOCYTOSIS BY HUMAN MACROPHAGES. The Journal of urology, 195(4 Pt 1), 1143-1151.

+ Open protocol

+ Expand

Quantification of HCMV Genomes in Mouse Spleen

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from portions of mouse spleen using DNAzol (ThermoFisher) and primers and probe recognizing HCMV UL141 were used to quantify viral genomes by quantitative real-time PCR as previously described [28 (link)]. Dilutions of purified HCMV BAC DNA were used to create a standard curve. A 1 μg sample of total DNA was added to each reaction well of TaqMan FastAdvance PCR master mix (Applied Biosystems) and samples were analyzed in triplicate on a StepOnePlus TaqMan PCR machine (Applied Biosystems) with an initial activation at 50°C for 2 min and 95°C for 20 s, followed by 40 cycles of 1 s at 95°C and 20 s at 60°C. TaqMan results were analyzed using ABI StepOne software and graphed using Prism 9.0 software.

Medica S., Crawford L.B., Denton M., Min C.K., Jones T.A., Alexander T., Parkins C.J., Diggins N.L., Streblow G.J., Mayo A.T., Kreklywich C.N., Smith P., Jeng S., McWeeney S., Hancock M.H., Yurochko A., Cohen M.S., Caposio P, & Streblow D.N. (2023). Proximity-dependent mapping of the HCMV US28 interactome identifies RhoGEF signaling as a requirement for efficient viral reactivation. PLOS Pathogens, 19(10), e1011682.

+ Open protocol

+ Expand

Quantifying HCMV Viral Genomes in Mouse Tissues and CD34+ HPCs

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from portions of mouse spleen or liver using DNAzol (ThermoFisher) as previously described (60 (link)) or from CD34⁺ HPCs using the two-step TRIzol (ThermoFisher) method by following the manufacturer’s protocol. Primers and probe recognizing HCMV UL141 were used to quantify viral genomes by quantitative real-time PCR (primer and probe sequences are listed in Table 1) compared to a standard curve generated using purified HCMV BAC DNA. For tissue samples, 1 μg of total DNA was added to each reaction well of TaqMan FastAdvance PCR master mix (Applied Biosystems), and the samples were analyzed in triplicate on a StepOnePlus TaqMan PCR machine (Applied Biosystems) with an initial activation at 50°C for 2 min and 95°C for 20 s, followed by 40 cycles of 1 s at 95°C and 20 s at 60°C. TaqMan results were analyzed using ABI StepOne software and graphed using Prism 6 software. For HPC samples, the entire DNA fraction was analyzed in triplicate as described above, and data were normalized to total copies of human beta-globin as previously described (39 (link)).

Crawford L.B., Caposio P., Kreklywich C., Pham A.H., Hancock M.H., Jones T.A., Smith P.P., Yurochko A.D., Nelson J.A, & Streblow D.N. (2019). Human Cytomegalovirus US28 Ligand Binding Activity Is Required for Latency in CD34+ Hematopoietic Progenitor Cells and Humanized NSG Mice. mBio, 10(4), e01889-19.

+ Open protocol

+ Expand

Quantitative PCR for HCMV Genome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from approximately 1-mm² sections of mouse spleen or liver using a DNAzol kit (Life Technologies). HCMV genomes were analyzed using quantitative PCR (TaqMan) performed on 1 µg of total DNA and TaqMan FastAdvance PCR master mix (Applied Biosystems, Foster City, CA), according to the manufacturer’s instructions. Primers and a probe recognizing HCMV UL141 were used to quantify HCMV genomes (probe, 5′-CGAGGGAGAGCAAGTT; forward primer, 5′-GATGTGGGCCGAGAATTATGA; reverse primer, 5′-ATGGGCCAGGAGTGTGTCA). The probe contained a 5′ 6-carboxyfluorescein (FAM) reporter molecule and a 3′ quencher molecule (Applied Biosystems). The reaction was initiated using TaqMan Fast Advanced master mix (Applied Biosystems) activated at 95°C for 10 min followed by 40 cycles (15 s at 95°C and 1 min at 60°C) using a StepOnePlus TaqMan PCR machine. Results were analyzed using ABI StepOne software.

Caviness K., Bughio F., Crawford L.B., Streblow D.N., Nelson J.A., Caposio P, & Goodrum F. (2016). Complex Interplay of the UL136 Isoforms Balances Cytomegalovirus Replication and Latency. mBio, 7(2), e01986-15.

+ Open protocol

+ Expand

Quantification of HCMV Genomes in Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from approximately 1 mm² sections of mouse spleen or liver using the DNAzol reagent (Life Technologies). HCMV genomes were analyzed using quantitative PCR (TaqMan) performed on 1 ug of total DNA and using TaqMan FastAdvance PCR Master Mix (Applied Biosystems), according to the manufacturer’s instructions. Primers and a probe recognizing HCMV UL141 were used to quantify HCMV genomes (probe: CGAGGGAGAGCAAGTT; forward primer: 5′GATGTGGGCCGAGAATTATGA and reverse primer: 5′ATGGGCCAGGAGTGTGTCA). The probe contains a 5′ FAM reporter molecule and a 3′ quencher molecule (Applied Biosystems). The reaction was activated at 95 °C for 10 minutes followed by 40 cycles (15 s at 95 °C and 1 min at 60 °C) using a StepOnePlus TaqMan PCR machine. Results were analyzed using ABI StepOne software (Applied Biosystems).

Crawford L.B., Tempel R., Streblow D.N., Kreklywich C., Smith P., Picker L.J., Nelson J.A, & Caposio P. (2017). Human Cytomegalovirus Induces Cellular and Humoral Virus-specific Immune Responses in Humanized BLT Mice. Scientific Reports, 7, 937.

+ Open protocol

+ Expand

Quantification of HCMV Genomes in Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total DNA was extracted from approximately 1 mm² sections of mouse spleen or liver using the DNAzol reagent (Life Technologies). Quantitative PCR (TaqMan) was performed on 1 µg of total DNA using TaqMan FastAdvance PCR Master Mix (Applied Biosystems), according to the manufacturer’s instructions. Primers and a probe recognizing HCMV UL141 were used to quantify HCMV genomes (probe: 5′CGAGGGAGAGCAAGTT; forward primer: 5′GATGTGGGCCGAGAATTATGA and reverse primer: 5′ATGGGCCAGGAGTGTGTCA). The probe contains a 5′ FAM reporter molecule and a 3′ quencher molecule (Applied Biosystems). The reaction was activated at 95 °C for 10 minutes followed by 40 cycles (15 s at 95 °C and 1 minute at 60 °C) using a StepOnePlus TaqMan PCR machine. Results were analyzed using ABI StepOne software (Applied Biosystems).

Caposio P., van den Worm S., Crawford L., Perez W., Kreklywich C., Gilbride R.M., Hughes C.M., Ventura A.B., Ratts R., Marshall E.E., Malouli D., Axthelm M.K., Streblow D., Nelson J.A., Picker L.J., Hansen S.G, & Früh K. (2019). Characterization of a live-attenuated HCMV-based vaccine platform. Scientific Reports, 9, 19236.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!