Genomic tip 500 columns

The DNA methylation levels of specific CpG sites of miR‐502‐5p in the promoter region were determined by MethylTarget sequencing (Genesky Biotechnologies Inc), a method using next‐generation sequencing‐based multiple targeted CpG methylation analysis.20, 21 Primer design and validation were performed by Methylation Primer software on bisulphate‐converted DNA. Primer sets were designed to flank each targeted CpG site in 100‐300 nucleotide regions. Genomic DNA was extracted from frozen samples using Genomic Tip‐500 columns (Qiagen) and from bisulphite‐converted using the EZ DNA Methylation™‐GOLD Kit (Zymo Research) according to the manufacturer's protocols. After PCR amplification (HotStarTaq polymerase kit, TAKARA) and library construction, samples were sequenced (Illumina MiSeq Benchtop Sequencer) using the paired‐end sequencing protocol according to the manufacturer's guidelines.22After bisulphite conversion, the CpG islands of E‐cadherin in the promoter region were amplified by PCR with primers (primer‐F: TTTGTTTTGTTATTTAGGTTGGAG, primer‐R: TAACCAACTTAATAAAACCCCATC). The PCR products were cloned into the pUC18‐T vector. After amplification, 5 clones were sent for DNA sequencing (Sangon).

DNA methylation at specific CpG sites was determined by MethylTarget sequencing (Genesky Biotechnologies Inc., Shanghai, China), using next-generation sequencing-based multiple targeted CpG methylation analysis.^{41 (link),42 (link)} Primer design and validation were performed using Methylation Primer software on bisulfate-converted DNA. Primer sets were designed flanking each targeted CpG site in a 100–300 nucleotide region and are shown in Supplementary Table 3. Genomic DNA was extracted from frozen samples using Genomic Tip-500 columns (Qiagen, Valencia, CA, USA) and from bisulfite-converted samples using an EZ DNA Methylation™-GOLD Kit (Zymo Research, CA, USA) according to the manufacturer’s instructions. After PCR amplification (HotStarTaq polymerase kit, TAKARA, Tokyo, Japan) and library construction, samples were sequenced (Illumina HiSeq Benchtop Sequencer, CA, USA) by paired-end sequencing according to the manufacturer’s guidelines.^{43 (link)}

Genomic DNA was extracted from frozen samples using Genomic Tip-500 columns (Qiagen, Valencia, CA, USA) and from bisulfite-converted samples using the EZ DNA Methylation™-GOLD Kit (Zymo Research, CA, USA) in accordance with the manufacturer’s instructions. Genomic DNA integrity was measured using agarose gel electrophoresis and quality control was ensured using a NanoDrop 2000 (NanoDrop technologies, Wilmington, DE, USA), which requires that the DNA concentration ≥ 20 ng/μL, and that the total amount of DNA ≥ 1 μg.