Dntps

Total DNAs and RNAs were extracted from leaves of two parental plants using CTAB and TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), respectively. First-strand cDNA was synthesized using a FastKing RT Kit (with gDNase) (Tiangen Biotech, Beijing, China). The PCR was carried out in a total volume of 25 μL containing 12.5 μL 2 × PCR buffer for KOD FX (Toyobo, Osaka, Japan), 0.5 μL KOD FX (1.0 U/μL) (Toyobo), 5.0 μL dNTPs (2 mM) (Toyobo), 0.5 μL of each primer (10 μM) (F: 5′-ATGGGAAGCATCAAAATAACCG-3′; R: 5′-TTAACCTACTTTAACCTGGCTG-3′), 2.0 μL cDNA (50 ng/μL) and 4.0 μL sterilized ddH₂O. Amplifications of candidate genes were performed under the following conditions: 95 °C for 5 min; 33 cycles of 30 s at 95 °C, 45 s at 55 °C and 45 s at 72 °C, followed by a final extension step at 72 °C for 10 min. Amplification products were analyzed on 1.5% agarose gel and sent for sequencing.

qRT-PCR was performed to determine the expression of osteogenic markers (OCN gene and DMP1 gene). Briefly, total RNA was extracted using TRIzol reagent (Ambion®; Life Technologies, Carlsbad, CA, USA). After quantification of total RNA with a spectrophotometer (Nano Drop® ND-1000, Thermo Fisher Scientific, Waltham, MA, USA), RNA samples were reverse-transcribed into complementary DNA (cDNA) using oligo (dT)12–18 primers (Life Technologies), dNTPs (Toyobo Co. Ltd, Osaka, Japan) and ReverTra Ace® (Toyobo Co., Ltd.) according to the manufacturer’s instructions. qRT-PCR were performed in a thermal cycler (Thermal Cycler Dice Real Time System II TP-900, Takara Bio, Japan) using SYBR Premix Ex TaqII reagent (Takara Bio, Kusatsu, Japan) according to the manufacturer’s protocol. Primer sets (Sigma-Aldrich Co.) used for the PCR experiment were listed in Table 1.Table 1

qRT-PCR primer sets.

Table 1

Primer	Direction	Sequence (5’-3’)
β-Actin	forward	CATCCGTAAAGACCTCTATGCCAAC
	reverse	ATGGAGCCACCGATCCACA
DMP1	forward	AGTGAGTCATCAGAAGAAAGTCAAGC
	reverse	CTATACTGGCCTCTGTCGTAGCC
Ocn	forward	CTCTGTCTCTGACCTCACAG
	reverse	GGAGCTGCTGTGACATCCATAC

Primer sequences are presented in Supplementary Table S2. Total RNAs in the liver and ileum were prepared using RNeasy mini kits (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. mRNA expression was measured with a Quant3 Real-Time PCR System and PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) using cDNA prepared by RT-PCR. The reaction mixture for RT-PCR was prepared with 10 mM dNTPs (TOYOBO Co., Ltd., Osaka, Japan), 0.3 μg/mL Random primer (Life Technologies Japan, Tokyo, Japan), ReverTra ace Buffer (ReverTra ace, TOYOBO Co., Ltd., Osaka, Japan) and mixed into 5μg RNA/11.5μL RNAase-free water. The reaction was carried out by RT-PCR at 30 °C for 10 min, 42 °C for 60 min, and 99 °C for 5 min. The sample was diluted 20-fold with RNAase-free water to form cDNA template, which was used to measure mRNA expression. The 2^−ΔΔCT method was utilized for data analysis. The reference gene was 36B4. The ΔΔCT is the difference between the ΔCT for the BG diets and control diet. Relative expression levels are presented as fold changes to the control group (arbitrary unit).

The tail of each embryo or pup was cut and transferred to a 1.5-mL microfuge tube, and 50 mM NaOH was added and heated at 95 °C for 30 min. After heating, 1 M Tris-HCl (pH 8.0) was added to each tube, and genomic DNA was subsequently extracted and used for PCR amplification. Briefly, a 0.5-μL aliquot of genomic DNA was added to the reaction mixture containing 0.625 U rTaq DNA polymerase (TOYOBO Co., Ltd., Osaka, Japan), 10× buffer (Mg⁺-free) (TOYOBO), 25 mM MgCl₂ (TOYOBO), 2 mM dNTPs (TOYOBO), and 10 μM PCR primers. The sequences of the PCR primers are as follows: Sry primers, 5′-TCAAGCGCCCCATGAATGCATT-3′ (forward) and 5′-ATATTTATAGTTTGGGTATTTCTC-3′ (reverse) [29 (link)]; Myogenin primers, 5′-TTACGTCCATCGTGGACAGC-3′ (forward) and 5′-GCTGGGTGTTAGTCTTA-3′ (reverse) [30 (link)]. The reaction was initially heated at 94 °C for 10 min, followed by 40 cycles of 94 °C for 20 s, 53 °C for 20 s and 74 °C for 1 min. Thermocycling was performed on a TaKaRa PCR Thermal Cycler Dice (Takara Bio Inc., Otsu, Japan). The sizes of the amplified PCR products are 209 bp (Sry) and 246 bp (Myogenin). The products were separated on 2% agarose gels, and the bands were visualized with an UV transilluminator (WiseUv WUV-M20; Atto Co., Tokyo, Japan) and detected by a light-capture cooled CCD camera system (AE-6981; Atto Co.).

Total RNA was extracted using QIAzol and purified with a RNeasy Lipid Tissue Mini Kit (Qiagen Sciences, Germantown, MD, USA). Reverse transcription was conducted with ReverTra Ace^TM (TOYOBO, Osaka, Japan), random primers (TOYOBO), and dNTPs (TOYOBO). For qPCR analysis, cDNA and primers were added to the THUNDERBIRD SYBR qPCR Mix (TOYOBO). PCR reactions were then performed using StepOnePlus^TM (Applied Biosystems, Foster City, CA). The primers used can be found in the Supplementary Table 1.

qRT-PCR was performed to determine the expression levels of stem cell markers, osteogenic and neurogenic markers in spheroids, and CBDCs from spheroids or monolayer culture. Briefly, total RNA was extracted using the TRIzol reagent (Ambion®; Life Technologies, Carlsbad, CA, USA). After quantification of total RNA with a spectrophotometer (NanoDrop® ND-1000, Thermo Fisher Scientific, Waltham, MA, USA), RNA samples were reverse transcribed into complementary DNA (cDNA) using oligo (dT)12–18 primers (Life Technologies), dNTPs (Toyobo Co. Ltd., Osaka, Japan), and ReverTra Ace® (Toyobo Co. Ltd.) according to the manufacturer's instructions. qRT-PCR was performed in a thermal cycler (Thermal Cycler Dice Real Time System II TP-900, Takara Bio, Japan) using the SYBR Premix Ex TaqII reagent (Takara Bio, Kusatsu, Japan) according to the manufacturer's protocol. Primer sets (Sigma-Aldrich Co.) used for the PCR experiment are listed in Table 2.