P27 sc 528

Manufactured by Santa Cruz Biotechnology

Sourced in United States

The P27 (sc-528) is an antibody product from Santa Cruz Biotechnology. It is used for the detection of the p27 protein in various applications.

Automatically generated - may contain errors

Lab products found in correlation

Anti vimentin ab92547, by Abcam (2 mentions) Keratin 18, by BioLegend (2 mentions) Anti keratin 5, by BioLegend (2 mentions) Anti e cadherin, by BD (2 mentions) Ecl reagent, by Santa Cruz Biotechnology (1 mentions) Myod sc 760, by Santa Cruz Biotechnology (1 mentions) Lamin b2, by Thermo Fisher Scientific (1 mentions) β actin a5316, by Merck Group (1 mentions) Ab8152, by Abcam (1 mentions) Brdu antibody, by BD (1 mentions) Lapatinib, by Abcam (1 mentions) Flag tag (flag), by Merck Group (1 mentions) Cleaved caspase 3, by Cell Signaling Technology (1 mentions) Phospho akt ser473, by Cell Signaling Technology (1 mentions) γ tubulin, by Merck Group (1 mentions) Phospho rb ser807 811, by Cell Signaling Technology (1 mentions) P44 42 mapk erk1 2, by Cell Signaling Technology (1 mentions) Raf 1 craf, by Santa Cruz Biotechnology (1 mentions) Cyclin e, by Santa Cruz Biotechnology (1 mentions) Phospho rb ser780, by Cell Signaling Technology (1 mentions)

7 protocols using p27 sc 528

Western Blot Analysis of Key Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equal amounts of proteins were separated by SDS-PAGE. After blocking the membrane with 5 % skim milk for 1 h at room temperature, the membranes were incubated with primary antibodies against NFAT (sc-271127), MyoD (sc-760), p-MARCKS (sc-101730), and p27 (sc-528; all Santa Cruz Biotechnology), LaminB2 (sab2702205; Thermo Fisher Scientific), and β-actin (A5316; Sigma-Aldrich Corp.) overnight at 4 °C. The membrane was washed and incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibodies. The bands were detected by an enhanced chemiluminescence (ECL) reagent (Santa Cruz Biotechnology). The band intensities were quantified using NIH Image J version 1.34e software.

Seo H.H., Lee C.Y., Lee J., Lim S., Choi E., Park J.C., Lee S, & Hwang K.C. (2016). The role of nuclear factor of activated T cells during phorbol myristate acetate-induced cardiac differentiation of mesenchymal stem cells. Stem Cell Research & Therapy, 7, 90.

+ Open protocol

+ Expand

Lentiviral Knockdown of p27 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral vector GIPZ-p27shRNA (V3LHS_410220) targeting the 3′-UTR of p27 was purchased from Thermo Scientific. The shorthair pin sequences are as follows:
TGCTGTTGACAGTGAGCGCCACAATAACACT AAAATTTTATAGTGAAGCCACAGATGTATAAAATT TTAGTGTTATTGTGTTGCCTACTGCCTCGGA. P27 mutants were generated by site-directed mutagenesis and full length p27 mutants were subcloned into the retroviral pBABE-hyrgomycin.
Primary antibodies used for western blots were: p27 (sc-528; Santa Cruz Biotechnology), γ-tubulin (T6557; Sigma-Aldrich), Flag (F3165; Sigma-Aldrich), Akt (Cat#9272, Cell Signaling), phospho-Akt (Ser473) (Cat#9271, Cell Signaling). For flow cytometry, BrdU antibody (Cat#556028; BD Pharmingen) was used. For immunostaining, the primary antibodies included BrdU antibody (ab8152; Abcam), cleaved caspase 3 (Cat#9664, Cell Signaling), and p27 (119–2; generated in the lab). Alexa Fluor-488 or Alexa Fluor-647 conjugated goat anti-rabbit or goat anti-mouse (Invitrogen) were used as secondary antibodies for immunostaining. Lapatinib is from BioVision (Cat#1624–100).

Zhao H., Faltermeier C.M., Mendelsohn L., Porter P.L., Clurman B.E, & Roberts J.M. (2015). Mislocalization of p27 to the cytoplasm of breast cancer cells confers resistance to anti-HER2 targeted therapy. Oncotarget, 5(24), 12704-12714.

+ Open protocol

+ Expand

Western Blot Analysis of Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were incubated with or without agents as indicated, and harvested. The cells were then re-suspended in lysis buffer (50 mM Tris-HCl, 1% SDS, 2 µg/mL leupeptin, 2 µg/mL aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, and 0.1% 2-mercaptoethanol). The lysate was sonicated and centrifuged at 15,000 g for 20 min at 4°C, and the supernatant was collected. Equal amounts of lysate were analysed by SDS-PAGE and transferred to PVDF membranes (Millipore). Primary antibodies were obtained for the following proteins: MEK1/2 (#9122), phospho-MEK1/2 Ser217/221 (#9121), p44/42 MAPK (ERK1/2) (#9102), phospho-p44/42 MAPK (ERK1/2) Thr202/Tyr204 (#9101), phospho-RB Ser780 (#9307), phospho-RB Ser807/811 (#9308) (Cell Signaling Technology, Inc.), p27 (sc-528), cyclinE (sc-247), Raf-1 (CRAF) (sc-7267), Raf-B (BRAF) (sc-55522) (Santa Cruz Biotechnology, Inc.), β-actin (Sigma), RB (BD Bioscience), and cyclinD1 (K0062-3) (Medical and Biologic Laboratories). The blots were blocked in blocking buffer (5% skim milk/TBST) for 1 h at room temperature, and incubated with the appropriate primary antibody in blocking buffer for 1 h at room temperature. The blots were then washed and incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h, and signals were detected with the Immobilon Western Chemiluminescent HRP Substrate (Millipore).

Wada M., Horinaka M., Yamazaki T., Katoh N, & Sakai T. (2014). The Dual RAF/MEK Inhibitor CH5126766/RO5126766 May Be a Potential Therapy for RAS-Mutated Tumor Cells. PLoS ONE, 9(11), e113217.

+ Open protocol

+ Expand

Evaluating Epithelial-Mesenchymal Transition

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-GAPDH (sc-47724), p16^INK4A (sc-468), p14^ARF (sc-8613), p63 (sc-25268, RRID:AB_628092), laminin β1 (sc-33709), integrin β1 (sc-59827), cyclin B1 (sc-245, RRID:AB_627338), and p27 (sc-528, RRID:AB_632129) were purchased from Santa Cruz Biotechnologies (Dallas, TX, USA). Anti-p53 (OP43–100UG, RRID:AB_213402) was purchased from Oncogene, (Cambridge, MA, USA). Anti-Keratin 5 (#905503) and Keratin 18 (#628401) were purchased from BioLegend (San Diego, CA, USA). Anti-CK18 (#4548), phospho-RB (#9313S), and Anti-AR (#5153S) were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-Vimentin (ab92547) was from Abcam (Cambridge, MA, USA). Anti-E-Cadherin (610181, RRID:AB_397580) was from BD Biosciences (San Jose, CA, USA).

Valentine H., Aiken W., Morrison B., Zhao Z., Fowle H., Wasserman J.S., Thompson E., Chin W., Young M., Clarke S., Gibbs D., Harrison S., McLaughlin W., Kwok T., Jin F., Campbell K.S., Horvath A., Thompson R., Lee N.H., Zhou Y., Graña X., Ragin C, & Badal S. (2022). Expanding the Prostate Cancer Cell Line Repertoire with ACRJ-PC28, an AR-negative Neuroendocrine Cell Line Derived From an African-Caribbean Patient. Cancer Research Communications, 2(11), 1355-1371.

+ Open protocol

+ Expand

Comprehensive Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-GAPDH (sc-47724), p16^INK4A (sc-468), p14^ARF (sc-8613), p63 (sc-25268, RRID:AB_628092), laminin β1 (sc-33709), integrin β1 (sc-59827), cyclin B1 (sc-245, RRID:AB_627338), and p27 (sc-528, RRID:AB_632129) were purchased from Santa Cruz Biotechnology. Anti-p53 (OP43-100UG, RRID:AB_213402) was purchased from Oncogene. Anti-Keratin 5 (#905503) and Keratin 18 (#628401) were purchased from BioLegend. Anti-CK18 (#4548), phospho-RB (#9313S), and Anti-AR (#5153S) were purchased from Cell Signaling Technology. Anti-Vimentin (ab92547) was from Abcam. Anti-E-Cadherin (610181, RRID:AB_397580) was from BD Biosciences.

+ Open protocol

+ Expand

Taspase1 Knockdown in Breast Cancer Cell Lines

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

BT-474 and HCC1419 cell lines were obtained from American Type Culture Collection and cultivated for no more than 2 months after each frozen aliquot was thawed. Amphotropic retrovirus carrying Taspase1 specific knockdown hairpin was generated as described^{26 (link),29 (link)}. To assay cell proliferation, 1 × 10⁵ cells were seeded onto each well of a 6-well plate and counted 4 days later. Cell cycle and cell death analyses were performed as described^{26 (link)}. For western blot, cells and tissues were lysed in standard RIPA buffer. The anti-Taspase1 rabbit polyclonal antibody is as described^{22 (link),26 (link)}. Antibodies for cyclin E2 (4132, Cell Signaling), cyclin A (C4710, Sigma), p21 (sc-397, Santa Cruz Biotechnology), p27(sc-528, Santa Cruz Biotechnology), cyclin D1(sc-450, Santa Cruz Biotechnology), p16(554079, BD Pharmingen), and ErbB2(OP-15, Calbiochem) were purchased from indicated companies. Antibodies were detected using the enhanced chemiluminescence method (Western Lightning, PerkinElmer). Immunoblot signals were acquired with the LAS-3000 Imaging system (FujiFilm) and were analyzed with ImageJ software.

Dong Y., Van Tine B.A., Oyama T., Wang P.I., Cheng E.H, & Hsieh J.J. (2014). Taspase1 cleaves MLL1 to activate cyclin E for HER2/neu breast tumorigenesis. Cell Research, 24(11), 1354-1366.

+ Open protocol

+ Expand

Vinorelbine and Everolimus Combination Therapy

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vinorelbine (Navelbine^®) (10 mg/mL) was obtained from Pierre Fabre Medicament (Boulogne, France) and was dissolved in PBS to a final concentration of 0.375 mg/mL before use. Everolimus (RAD001) was obtained from Novartis (Basel, Switzerland) and dissolved in a vehicle (30% Captisol^® in water) to achieve the appropriate concentration for the treatments.
Antibodies against AKT (#9272), p70S6K (#9202), survivin (#2803), S6R (#2217), Rb (#9313), Cyclin B1 (#4138), eIF4E (#9742), Cdc25C (#4688), cleaved caspase 3 (#9661), cleaved caspase 7 (#9491), cleaved PARP (#5625), Cyclin D1 (#2978), Cdc2 (#9112), and α-Tubulin (#2144) and phosphorylation-specific antibodies against RB Ser807/811 (#9308), AKT Ser473 (#9271), mTOR Ser2448 (#5536), p70S6K Thr421/424 (#9204), S6R Ser235/236 (#4858), 4EBP1 Thr70 (#9455), Histone H3 Ser10 (#9701), Cyclin D1 Thr286 (#3300), Cdc25C Ser216 (#4901), Cdc2 Tyr15 (#9111), eIF4E Ser209 (#9741), and ERK1/2 Thr202/Tyr204 (#4370) were obtained from Cell Signaling Technology (Beverly, MA, USA). RKIP (#37-2100) was obtained from Invitrogen. p-Cdk2 Thr14/Tyr15 (sc-28435-R), ERK1/2 (sc-94), and p27 (sc-528) were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Anti-mouse CD31 (#2502) antibody was purchased from BioLegend (San Diego, CA, USA).

Huynh H., Ng W.H, & Soo K.C. (2023). Everolimus Acts in Synergy with Vinorelbine to Suppress the Growth of Hepatocellular Carcinoma. International Journal of Molecular Sciences, 25(1), 17.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!