Platinum super mix

gDNA was extracted from library-infected HPDE-iKRAS^G12D cells (injected or Input) and three individual tumour cores (output) for quadruplicate and triplicate, respectively, PCR reactions to amplify the BC pools present within each sample using Platinum Super Mix (Life Technologies) and flanking primers common to each BC: 5′-CAATTAACCCTCACTAAAGG-3′ and 5′-CCGCCACTGTGCTGGATA-3′). Amplification parameters were as follows: 1 × [94 °C-4']; 35 × [94 °C-1', 54 °C-1', 68-1']; 1 × [68 °C-10']. Each replicate PCR amplicon (178 nt) was purified for PGM library preparation, where each amplicon was ligated to unique Ion Xpress Barcode Adaptors for PGM sequencing (318 V2 Chip) following the manufacturer's recommendations. Raw data were concatenated into one ‘reference' file and indexed using burrows-wheeler alignment tool40 (link) for alignment of BC sequences (with parameters ‘-l7 -t12 -N -n3') for counting the occurrence of each BC. BC enrichment was assessed by quantitating the number of occurrences for each BC sequence as a ratio to total number of BC reads in each sample. S.d.'s were calculated for quadruplicate and triplicate reactions for input and output samples, respectively, and were plotted as error bars on the BC enrichment graphs.

The immediate early gene cfos is commonly used as a marker of neural activation. To visualize cfos mRNA in the brain, we used chromogenic in situ hybridization (ISH) with a riboprobe specific to the A. burtoni cfos mRNA sequence. Primers were designed based on the sequence available in Genbank (HQ232413.1) and commercially synthesized (Life Technologies; forward primer: 5′-agagaactgatcgggagcagcgct-3′; reverse primer: 5′-caggttgggatatcattctgcagg-3′). Probe template was generated by PCR amplification (Platinum SuperMix, Life Technologies) of whole brain A. burtoni cDNA, cfos gene-specific primers, and the following reaction conditions: 95°C for 1 min, 45 cycles of: (95°C for 15 s, 55°C for 15 s, 72°C for 1 min), and 72°C for 1 min. A transcription reaction was used to incorporate DIG (DIG-labeling mix, Roche)-labeled nucleotides into the purified PCR template (MinElute PCR Kit, Qiagen) before probe purification (GE Illustra Probe Quant G-50 microcolumns). PCR products and the final probe were checked on a 1% agarose gel after each step and verified as a band of the correct size. The probe was then diluted 1:5 in hybridization buffer and stored at −20°C until use. Probes were transcribed using the T3 polymerase transcription initiation sequence (aattaaccctcactaaaggg) that was added to the reverse (for anti-sense probes) or forward (for sense control probes) primer.