Floret tissue samples from days 1, 3, and 5 were chosen for expression analysis of genes related to the glucosinolate biosynthetic pathway. Total RNA was isolated from broccoli floret using the TRIZOL (Ambion, Life Technologies, USA) method with DNase treatment (Turbo DNA free, Thermofisher, USA). First-strand cDNA synthesis from 1 μg of total RNA was performed using a reverse transcription kit (Applied Biosystems, Foster City, CA). For the quantitative real-time RT-PCR, the primers were designed using Primer-Quest from Integrated DNA Technologies (IDT). The primers for the genes of glucosinolate biosynthetic pathway are listed in Table 1 . Real-time PCR reaction was performed in an Applied Biosystems qPCR machine (Thermofisher, USA). The total reaction volume was 10 μl for each gene, and the reactions were run in triplicate with thermocycler conditions as follows: 95 °C for 10 min, 45 cycles of 95 °C for 30 sec, and 60 °C for 30 sec. The relative gene expression was calculated by ΔΔCT method according to the qPCR machine manufacturer (Thermofisher, USA). The Actin2 from broccoli was used as an internal control. The experiment was repeated twice for expression studies.
Qpcr machine
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan
The QPCR machine is a laboratory instrument used for quantitative polymerase chain reaction (qPCR) analysis. It is designed to amplify and quantify specific DNA or RNA sequences in a sample. The core function of the QPCR machine is to provide precise and sensitive measurement of target nucleic acid levels through real-time monitoring of the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Taqman gene expression assay, by Thermo Fisher Scientific (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Rneasy plus mini kit, by Qiagen (4 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Thermo Fisher Scientific (2 mentions)
Direct zol rna miniprep kit, by Zymo Research (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Microamp optical 96 well reaction plate, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Sypro orange, by Merck Group (1 mentions)
Tb green, by Takara Bio (1 mentions)
Rna reverse transcription kit, by Takara Bio (1 mentions)
Qubit rna hs assay kit, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 4 vilo master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy plus micro kit, by Qiagen (1 mentions)
Primescripttm rt reagent kit, by Takara Bio (1 mentions)
24 protocols using qpcr machine
1
Broccoli Glucosinolate Pathway Expression Analysis
2
Quantitative RT-PCR Analysis of Stress Response Genes in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To perform quantitative RT‐PCR, we first collected worms in M9 buffer and extracted RNA using Trizol as described previously (Machiela et al., 2016 (link)). Using a High‐Capacity cDNA Reverse Transcription kit (Applied Biosystems 4368814), the isolated mRNA was then converted to cDNA. Quantitative PCR was performed using a PowerUp SYBR Green Master Mix (Applied Biosystems A25742) in a MicroAmp Optical 96‐Well Reaction Plate (Applied Biosystems N8010560) and a Viia 7 Applied Biosystems qPCR machine. mRNA levels were calculated as the copy number of the gene of interest relative to the copy number of the endogenous control, act‐3, and then expressed as a percentage of the unstressed control. Primer sequences for each target gene are as follows:
sod‐3 (AAAGGAGCTGATGGACACTATTAAGC, AAGTTATCCAGGGAACCGAAGTC),
dod‐3 (AAGTGCTCCGATTGTTACGC, ACATGAACACCGGCTCATTC),
mtl‐1 (ATGGCTTGCAAGTGTGACTG, GCTTCTGCTCTGCACAATGA),
sodh‐1 (GAAGGAGCTGGAAGTGTTGTTC, CTCCACGTATAGTGAGGTACTCCTG),
ftn‐1 (GAGTGGGGAACTGTCCTTGA, CGAATGTACCTGCTCTTCCA),
icl‐1 (TGTGAAGCCGAGGACTACCT, TCTCCGATCCAAGCTGATCT),
act‐3 (TGCGACATTGATATCCGTAAGG, GGTGGTTCCTCCGGAAAGAA).
sod‐3 (AAAGGAGCTGATGGACACTATTAAGC, AAGTTATCCAGGGAACCGAAGTC),
dod‐3 (AAGTGCTCCGATTGTTACGC, ACATGAACACCGGCTCATTC),
mtl‐1 (ATGGCTTGCAAGTGTGACTG, GCTTCTGCTCTGCACAATGA),
sodh‐1 (GAAGGAGCTGGAAGTGTTGTTC, CTCCACGTATAGTGAGGTACTCCTG),
ftn‐1 (GAGTGGGGAACTGTCCTTGA, CGAATGTACCTGCTCTTCCA),
icl‐1 (TGTGAAGCCGAGGACTACCT, TCTCCGATCCAAGCTGATCT),
act‐3 (TGCGACATTGATATCCGTAAGG, GGTGGTTCCTCCGGAAAGAA).
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was prepared using RNeasy Plus Mini Kits (Qiagen). cDNA was prepared using QuantiTect Reverse Transcription kits (Qiagen). QPCR was performed using TaqMan Gene Expression Assays (Applied Biosystems) and an Applied Biosystems qPCR machine. mRNA expression levels were determined by comparing the Ct value of the mRNA of interest to that of the house-keeping gene GAPDH in the same preparation.
4
Thermal Stability Assay of hTEAD4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nonacylated hTEAD4
(20 μM) was incubated in the absence or presence of inhibitors
(80 μM) at 25 °C for 10 min. Then, SYPRO orange (Sigma-Aldrich)
at a final concentration of 5× was added and the mixture was
heated at a ramp rate of 1 °C/min in a qPCR machine (Applied
Biosystems). The derivative of the SYPRO orange fluorescent intensity
is plotted as a function of temperature.
(20 μM) was incubated in the absence or presence of inhibitors
(80 μM) at 25 °C for 10 min. Then, SYPRO orange (Sigma-Aldrich)
at a final concentration of 5× was added and the mixture was
heated at a ramp rate of 1 °C/min in a qPCR machine (Applied
Biosystems). The derivative of the SYPRO orange fluorescent intensity
is plotted as a function of temperature.
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using Trizol (Invitrogen, California, USA), and reversely transcribed to cDNA. Next, the q-PCR assays were performed using TB Green (Takara, Japan) with a q-PCR machine (Applied Biosystems, USA) according to manufacturer's protocol. The relative expression of mRNA was calculated by 2-△△Ct method. The sequences of the primers were listed as follows: β-Tubulin-F CTGCTCATCAGCAAAGTGCG, β-Tubulin-R TGCGGAAGCAGATGTCGTAG; SPATS2-F AAGAGAAGATAAATGCGGTACG, SPATS2-R TACTTCACTGGCACTACCTTCC; STAT3-F ATCACGCCTTCTACAGACTGC, STAT3-R CATCCTGGAGATTCTCTACCACT; TRIM44-F AGTAACTCGGGACCAAATGAAGA, TRIM44-R CATGTGGGATTGGATGTCTGC; BCL2-F GGTGGGGTCATGTGTGTGG, BCL2-R CGGTTCAGGTACTCAGTCATCC; MMP9-F TGTACCGCTATGGTTACACTCG, MMP9-R GGCAGGGACAGTTGCTTCT; HIF-1α-F GAACGTCGAAAAGAAAAGTCTCG, HIF-1α-R CCTTATCAAGATGCGAACTCACA; PIM1-F GAGAAGGACCGGATTTCCGAC, PIM1-R CAGTCCAGGAGCCTAATGACG.
6
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In accordance with the instructions of the RNA reverse transcription kit (TaKaRa), an RT-qPCR system (20 μL) was built for preparation of reverse transcription reagents. The reagent preparation was performed on ice. With well-mixed reagents and a qPCR machine (Applied Biosystems, USA), RT-qPCR was conducted to synthetize cDNA templates. The reaction condition was 30-min incubation at 37°C followed by 15-s incubation at 80°C. The RT-PCR products were preserved at −20°C until use. For measurement of miRNA-21, miRNA-23a, and miRNA-125b, U6 small nuclear RNA (snRNA) was selected as a reference gene and RT-qPCRs were conducted under the conditions of 40 cycles of 10-min incubation at 95°C, 15-s incubation at 95°C, and 1-min incubation at 60°C. Primers (forward and reverse) of miRNA-21, miRNA-23a, and miRNA-125b for RT-qPCR are listed in Table 1 . The value of gene expression was calculated with 2−ΔΔCt method (ΔΔCt=ΔCttumor–ΔCtnormal, ΔCt=CtmiRNA–CtU6snRNA).
7
Quantifying T Cell Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T cells were washed twice in PBS and then resuspended in 300µL of RLT buffer containing beta-mercaptoethanol. Rneasy Plus Micro Kit (Qiagen) was used according to the manufacture’s guidelines to further isolate RNA. RNA was quantified using Qubit RNA HS Assay Kit (ThermoFisher Scientific) or a NanoDrop Spectrophotometer (ThermoFisher Scientific). cDNA was generated using SuperScript IV VILO Master Mix (ThermoFisher Scientific). BHLHE40, IFN-γ, IL-4, IL-10, IL-2, and housekeeping genes including: RPLPO, GAPDH, and β-Actin were measured using TaqMan Gene Expression Assays with TaqMan Gene Expression Master Mix (ThermoFisher Scientific) in a 384 well plate with an Applied Biosystems qPCR machine. Relative fold gene expression was calculated using the 2–ΔΔCt method.
8
Wound Healing Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wound tissues, which were collected on the last day of the experiment, were used for gene expression studies. For RNA extraction, wounds were homogenized in TRI Reagent (Sigma-Aldrich) and total RNA was isolated according to the recommended protocol. cDNA synthesis was performed with TaKaRa PrimeScriptTM RT reagent kit (Perfect Real Time) (RR037A, TaKaRa, Bio Inc, Kusatsu, Shiga, Japan), following manufacturer instructions. The expression profile of key mediators of the wound healing process was determined. In particular, mRNA expression levels of TGF-β1, VEGF-A, Collagen1a1, CXCL1, CXCL2, CCL3, and CX3CL1 were analyzed by quantitative PCR (real-time PCR). B-actin was utilized as the internal control. A list of the primers used is presented in Table 2 . The reactions were performed in the qPCR machine (Applied Biosystems®, Foster City, CA, USA), while the mRNA transcription analysis was conducted via StepOneTM software v2.3 and GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA).
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was prepared using RNeasy Plus Mini Kits (Qiagen). cDNA was prepared using QuantiTect Reverse Transcription kits (Qiagen). QPCR was performed using TaqMan Gene Expression Assays (Applied Biosystems) and an Applied Biosystems qPCR machine. mRNA expression levels were determined by comparing the Ct value of the mRNA of interest to that of the house-keeping gene GAPDH in the same preparation.
10
In vivo Evaluation of miR-145 in LSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BALB/cA nu/nu male nude mice weighing 14–16 g (quality certification number 2007000553984; animal license number SYXK; Shanghai SLAC Laboratory Animal Center, Shanghai, China; 2009-0123), human LSCC AMC-HN-8 cells (Catalog number:BNCC338377, BeNa Culture Collection, Shanghai, China), transfection reagents (Engreen Biosystem, Beijing, China), miR-145 and non-specific gene sequences (Genepharma, Shanghai, China), ELISA kit (SunBio Technology, Beijing, China), RNA extraction kit (Qiagen, Duesseldorf, Germany), GoScript Reverse Transcription System (Promega, Madison, WI USA), GoTaq qPCR master mix (Promega), primary antibodies (Santa Cruz Biotechnology, Dallas, TX, USA), secondary antibody (Zhongshan Golden Bridge, Guangzhou, China), micro-spectrophotometer (ND-2000, USA), qPCR machine (Applied Biosystems, Waltham, MA, USA), and Power Wave XS full wavelength enzyme meter (Gene, San Francisco, USA) were used in this study. All animal-related protocols were approved by the Animal Ethical Care and Use Committee of the First Affiliated Hospital of Zhejiang University (Protocol Approval No. AEWC-2015-10), the rules and regulations for the administration of laboratory animals of Zhejiang University, Hangzhou, Zhejiang, China.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!