Total RNA in cells from different groups was extracted using RNA Purified Total RNA Extraction Kit according to the manufacturer's instruction (Calt. number RP1201, BioTeke, Beijing, China).β-Actin was selected as the internal reference gene. RNA was reversely transcribed to cDNA templates using super M-MLV reverse transcriptase (Calt. number RP6502, BioTeke, Beijing, China) and final qPCR reaction mixture (20 μL) consisted of 10 μL of SYBR GREEN mastermix (Catl. number SY1020, Solarbio, China), 0.5 μL of each of the primers (Notch, forward: 5′-CAAGGCACGGAGGAAGAAG-3′ and reverse: 5′-CCAGGTGAGTGTCAGGCATA-3′; Jagged, forward: 5′-CAACGACCGTAATCGCATC-3′ and reverse: 5′-GAAGTGGGCAATCCCTGTG-3′; Hes1, forward: 5′-TGACTGTGAAGCACCTCCG-3′ and reverse: 5′-AAGCGGGTCACCTCGTTCA-3′; Hes5, forward: 5′-CGCTCGCTAATCGCCTCCA-3′ and reverse: 5′-CGGTCCCGACGCATCTTCT-3′;β-actin forward: 5′-CTGTGCCCATCTACGAGGGCTAT-3′ and reverse: 5′-TTTGATGTCACGCACGATTTCC-3′), 1 μL of the cDNA template, and 8 μL of Rnase-free H2O. Amplification parameters were as follows: denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 10 s, 60°C for 20 s, and 72°C for 30 s, and the reaction was stopped at 4°C for 5 min. Relative expression levels of the targeted molecules were calculated with Exicycler™ 96 (BIONEER) according to the expression of 2−ΔΔct.
Rna purified total rna extraction kit
Manufactured by BioTeke
Sourced in China
The RNA Purified Total RNA Extraction Kit is a laboratory tool designed for the efficient extraction and purification of total RNA from a variety of biological samples. It utilizes a specialized protocol and reagents to isolate high-quality RNA suitable for downstream applications such as gene expression analysis, RT-PCR, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Super m mlv reverse transcriptase, by BioTeke (3 mentions)
Exicycler 96, by Bioneer (3 mentions)
Sybr green master mix, by Solarbio (1 mentions)
Exicycler 96 pcr system, by Bioneer (1 mentions)
7900ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Power taq pcr mastermix, by BioTeke (1 mentions)
4 protocols using rna purified total rna extraction kit
1
Quantitative Analysis of Notch Signaling
2
Real-time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the different samples was extracted using the RNA Purified Total RNA Extraction kit according to the manufacturer’s instructions (BioTeke, Wuxi, China). Total RNA was reverse transcribed into cDNA templates using Super M-MLV reverse transcriptase (BioTeke). The final RT-PCR reaction mixture of volume 20 µl consisted of 10 µl of Bestar® SUBR-Green qPCR master Mix, 0.5 µl of each primer (TOMM40 forward, 5′-CTT CCT CTT CAA AGG CTC TGT-3′ and reverse, 5′-ACT TAT TCT TGC GGT GGT TC-3′; TIMM17A forward, 5′-CTG GCA GCA AGA AAT GGA-3′ and reverse, 5′-AGG CAA ACC TGG TCA ACA-3′; APP forward, 5′-CCA CAT CGT GAT TCC TT ACC-3′ and reverse, 5′-CCA GAC ATC GGA GTC GTC C-3′; COX forward, 5′-AGC CAT TTC TAC TTC GGT GTG-3′ and reverse, 5′-ATT GGT GCC CTT GTT CAT CT-3′; and GAPDH forward, 5′-CCT CGT CTC ATA GAC AAG ATG GT-3′ and reverse, 5′-GGG TAG AGT CAT ACT GGA ACA TG-3′), 2 µl of the cDNA template and 7 µl of Rnase free H2O. The amplifi-cation parameters were set as follows: Denaturation at 94°C for 2 min, followed by 40 cycles at 94°C for 20 sec, 58°C for 20 sec, and 72°C for 20 sec. The relative mRNA expression levels were calculated with ExicyclerTM 96 (Bioneer Corporation, Daejeon, Korea) according to the expression of 2−ΔΔcq (25 (link)).
3
Quantitative Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from experimental HK-2 cells or the rat kidney tissues by using an RNA Purified Total RNA Extraction Kit (BioTeke, Beijing, China) according to the manufacturer’s instructions. Real-time PCR was performed with a 7900 HT Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primers used for RT-PCR were synthesized by Sangon Biotech (Shanghai, China) and are listed in Table 1 . The relative levels of expression of the targeted molecules were calculated by an Exicycler 96 PCR System (Bioneer, Alameda, CA, USA) that used the 2−ΔΔCt method. The expression levels were normalized to that of U6 or GAPDH, which served as internal reference genes.
Primers for Quantitative Real-Time PCR
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| miR-26a | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCCTATC | ACACTCCAGCTGGGTTCAAGTAATCCAGGATA |
| HIF-1α | GAACGTCGAAAAGAAAAGTCTCG | CCTTATCAAGATGCGAACTCACA |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
| TRPC6 | GTGATCGCTCCACAAGCCTAT | CTGCCAACTGTAGGGCATTCT |
| PARP1 | CGGAGTCTTCGGATAAGCTCT | TTTCCATCAAACATGGGCGAC |
| Sirtuin-2 | TGCGGAACTTATTCTCCCAGA | GAGAGCGAAAGTCGGGGAT |
| GADPH | TGTTCGTCATGGGTGTGAAC | ATGGCATGGACTGTGGTCAT |
4
Quantifying miR-21-3p Expression in Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two weeks after model induction, total RNA in brain tissues was extracted with RNA Purified Total RNA Extraction Kit (RP1201, BioTeke, Beijing, China) and reversely transcribed into cDNA with use of Super M-MLV reverse transcriptase (RP6502, BioTeke). The reaction mixture of RT2-PCR system contained 10 μL of 2 × Power Taq PCR MasterMix (PR1702, BioTeke), 0.5 μL of each primer (miR-21-3p, forward: 5′- ACACTCCAGCTGGGCAACACCAGTCGATGGGC-3′, reverse: 5′- CTCAACTGGTGTCGTGGA-3′; U6, forward: 5′- CTCGCTTCGGCAGCACA-3′; reverse, 5′- AACGCTTCACGAATTTGCGT-3′), 1 μL of the cDNA template, and 8 μL of RNase-free H2O. Amplification was performed routinely with ExicyclerTM 96 (BIONEER, Daejeon, Republic Korea), and the relative expression level of miR-21-3p was calculated according to the formula 2-△△ct.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!