Charcoal dextran stripped fbs

Manufactured by Thermo Fisher Scientific

Sourced in United States

Charcoal-dextran stripped FBS is a specialized cell culture media supplement. It is produced by treating fetal bovine serum (FBS) with activated charcoal and dextran to remove hormone-like compounds and other small molecules. This process results in a serum that is depleted of certain factors, making it suitable for specialized cell culture applications where control of the media composition is critical.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Charcoal-stripped FBS (128 citations) Dextran-coated charcoal-stripped FBS (5 citations) Charcoal-dextran (2 citations) Dextrans (2 citations)

12 protocols using charcoal dextran stripped fbs

ALA Modulates ERβ Expression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

After culturing overnight (37 °C, 5% CO₂), cells were starved in fresh medium containing ALA (0–1.0–10 mM) and cultured (37 °C, 5% CO₂) for 24 h. ALA (Thioctic Acid, Barenz Service SpA, Paderno Dugnano, Milan, Italy) was prepared by dissolving in absolute ethanol, and stock sample was further diluted in culture medium. The final concentration of absolute ethanol used in all of the experiments was 0.1%. The results from the treated cells were compared with the non-treated cell exposed to the 0.1% final concentration of absolute ethanol (controls: CTR).
To deplete endogenous steroids in the ERβ expression studies, the medium was changed to phenol red-free medium containing 10% charcoal/dextran stripped FBS (ThermoFisher Scientific, Rockford, IL, USA) for 24 h before ALA treatment.
Treated cells and supernatants were collected and stored at −80 °C until use in the western blot assay and ELISAs.

Di Nicuolo F., Castellani R., De Cicco Nardone A., Barbaro G., Paciullo C., Pontecorvi A., Scambia G, & Di Simone N. (2021). Alpha-Lipoic Acid Plays a Role in Endometriosis: New Evidence on Inflammasome-Mediated Interleukin Production, Cellular Adhesion and Invasion. Molecules, 26(2), 288.

+ Open protocol

+ Expand

Estrogen Modulation of T Cell Physiology

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood was collected from pre-menopausal healthy women in the
follicular phase of the menstrual cycle. Total T cells were purified by negative
selection using the Rosette Sep human T cell kit (StemCell Technologies) and
cultured in RPMI without phenol red, supplemented with charcoal-dextran-stripped
FBS (ThermoFisher), and cultured with reconstituted β-estradiol at
37°C.

Ramanujan S.A., Cravens E.N., Krishfield S.M., Kyttaris V.C, & Moulton V.R. (2021). Estrogen‐Induced hsa‐miR‐10b‐5p Is Elevated in T Cells From Patients With Systemic Lupus Erythematosus and Down‐Regulates Serine/Arginine‐Rich Splicing Factor 1. Arthritis & Rheumatology (Hoboken, N.j.), 73(11), 2052-2058.

+ Open protocol

+ Expand

Engineered dCas9 Fusion Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplification of KDM2A and truncated NEDD4 (with HECT domain) coding sequence by using primers: KDM2A-F: AGGgctagcgccaccATGGAACCCGAAGAAGAAAGG, KDM2A-R: AGGgctagcGGCATAATCGGGCACGTCATAGGGATAGCTGATCTTCTGTATCAGCTTCT C; NEDD4c-F: AGGgctagcgccaccATGAGAGCAGACTTCCTGAAGGCTCGA, NEDD4c-R: AGGgctagcggcgtagtcaggcacgtcgtaaggataATCAACTCCATCAAAGCCCT. The digested the CDS fragments and pST1374-Cas9-ZF-N-Blasticidin vector (a gift of Xingxu Huang lab, containing dCas9) by Nhe I, then ligated coding fragments with pST1374-Cas9-ZF-N-Blasticidin vector to expression dCas9-KDM2A or dCas9-trunc-NEDD4 fusion protein. After transfection of the plasmids into MCF-7 cells, two days later added blasticidin (working concentration 30 μg/ml) was added 2 days later to select positive expressed cells. After another three-days selection, cells were infected with sgRNA expression lenti-virus as mentioned in CRISPRi experiment, and selected with Puromycin for another three days in phenol red-free DMEM (GIBCO/Invitrogen) supplemented with 5% charcoal dextran-stripped FBS (GIBCO/Invitrogen), then cells were harvested and extracted RNA to detect mRNA and enhancer RNA expression.

Tan Y., Jin C., Ma W., Hu Y., Tanasa B., Oh S., Gamliel A., Ma Q., Yao L., Zhang J., Ohgi K., Liu W., Aggarwal A.K, & Rosenfeld M.G. (2018). Dismissal of RNA Polymerase II Underlies a Large Ligand-induced Enhancer Decommissioning Program. Molecular cell, 71(4), 526-539.e8.

+ Open protocol

+ Expand

Lentiviral shRNA Knockdown in MCF7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

pLKO lentiviral shRNA constructs and control shRNA constructs were purchased from Addgene. The sequences of the shRNAs used in this article are shown in Supplementary Table 4. Knockdown experiments with lentivirus shRNAs were conducted according to the standard lentivirus package and transduction protocols from Addgene. pLKO-based lentiviral shRNA plasmids were cotransfected with packaging plasmids (psPAX2 and pMD2.G) into 293 T cells. Lentiviruses were harvested, concentrated and used for MCF7 cell infection. Stable knockdown MCF7 cells were selected with 1 μg ml^–1 puromycin and collected for experiments within 5 days. Before collection, the cells were grown for 3 days in phenol red-free DMEM (GIBCO/Invitrogen) supplemented with 5% charcoal dextran-stripped FBS (GIBCO/Invitrogen) and 0.5 μg ml^–1 puromycin for continued selection to achieve better knockdown.

Tan Y., Yao L., Gamliel A., Nair S.J., Taylor H., Ohgi K., Aggarwal A.K, & Rosenfeld M.G. (2023). Signal-induced enhancer activation requires Ku70 to read topoisomerase1–DNA covalent complexes. Nature Structural & Molecular Biology, 30(2), 148-158.

+ Open protocol

+ Expand

Transient Transfection and Thyroid Hormone Receptor Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded at 2.0 × 10⁴ per well in a 96-well plate (PerkinElmer, Waltham, MA). Seventeen hours after seeding, cells were transiently transfected with 100 ng DNA, containing 25 ng each of expression plasmids for GFP-TRα1, TRE (DR+4)-firefly luciferase reporter, Renilla luciferase internal control, scrambled shRNA control or a set of four target-specific shRNAs. Transfection medium was replaced with complete medium 8 h post-transfection. Fourteen hours post-transfection, complete medium was replaced with 100 μl MEM containing 10% charcoal-dextran stripped FBS (Life Technologies), supplemented or not with 100 nM 3,3′,5-triiodo-L-thyronine (T₃, Sigma-Aldrich). After an additional 12 h, a Dual-Glo® Luciferase Assay (Promega) was performed, according to the manufacturer’s protocol, using 100 μl of reagent per well. Four independent, biologically separate replicate experiments were performed, with 8 wells assayed per treatment. Data were analyzed for statistical significance, as described in Section 2.8.

Roggero V.R., Zhang J., Parente L.E., Doshi Y., Dziedzic R.C., McGregor E.L., Varjabedian A.D., Schad S.E., Bondzi C, & Allison L.A. (2015). Nuclear Import of the Thyroid Hormone Receptor α1 is Mediated by Importin 7, Importin β1, and Adaptor Importin α1. Molecular and cellular endocrinology, 419, 185-197.

+ Open protocol

+ Expand

Evaluating Cohesin Deficiency Effects

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RPE cells^{45 (link)}, MCF-7 cells (JCRB Cell Bank) and immortalized fibroblast cells (generated in our previous study^{17 (link)}) were cultured in DMEM containing 10% FBS and 1% penicillin/streptomycin. Before subsequent treatments, RPE cells were cultured in serum-free medium for 48 h and then were incubated in DMEM containing 10% FBS for 30 min. MCF-7 cells were maintained in phenol red−free medium containing charcoal-dextran−stripped FBS (Life Technologies) at 70−80% confluency for 2 days before treatment with 50 nM E2 (beta-estradiol, SIGMA, E2758) for the indicated times. Rad21 stealth siRNAs UUCCACUCUACCUGAUUCAAGCUG (Thermo Fisher Scientific, also used in previous report^{4 (link)}) were transfected using Lipofectamine RNAiMax (Thermo Fisher Scientific, 13778150) according to the manufacturer’s instructions at 40 h before treatment with E2. DRB (TCI, D4292) was added at 1.5 h before treatment with E2. The effect of cohesin (Rad21)-deficiency was verified by western blot as shown in Supplementary Fig. 7a.

Wang J., Bando M., Shirahige K, & Nakato R. (2022). Large-scale multi-omics analysis suggests specific roles for intragenic cohesin in transcriptional regulation. Nature Communications, 13, 3218.

+ Open protocol

+ Expand

Transient Transfection Assay for Thyroid Hormone Receptor

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were seeded at 2.0 × 10⁴ per well in a 96-well plate (PerkinElmer, Waltham, MA). Seventeen hours after seeding, cells were transiently transfected with 100 ng DNA, containing 25 ng each of expression plasmids for GFP-TRα1 or GFP-TRβ1, TRE (DR+4)-firefly luciferase reporter, Renilla luciferase internal control, and mCherry, mCherry-XPO4, Myc, Myc-XPO5, HA, or HA-XPO7. Transfection medium was replaced with complete medium 6 h post-transfection. Twelve hours post-transfection, complete medium was replaced with 100 μl MEM containing 10% charcoal-dextran stripped FBS (Life Technologies), supplemented or not with 100 nM T₃. After an additional 12 h, a Dual-Glo® Luciferase Assay (Promega) was performed, according to the manufacturer’s protocol, using 100 μl of reagent per well.

Subramanian K.S., Dziedzic R.C., Nelson H.N., Stern M.E., Roggero V.R., Bondzi C, & Allison L.A. (2015). Multiple exportins influence thyroid hormone receptor localization. Molecular and cellular endocrinology, 411, 86-96.

+ Open protocol

+ Expand

MCF-10A Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-10A parental cell lines were purchased from American Type Culture Collection (ATCC). MCF-10A cell line knock-ins were generated as previously described [14 (link)]. All cell lines were grown in 5% CO₂ at 37°C with 1% Penicillin/Streptomycin in respective media conditions. Parental MCF-10A cell lines were cultured in DMEM/F12 (1:1) supplemented with 5% horse serum, 20 ng/ml epidermal growth factor (EGF), 10 μg/ml insulin (Roche), 0.5 μg/mL hydrocortisone (Sigma), and 100 ng/ml cholera toxin (Sigma). Knock-in cell lines were maintained in MCF-10A media in the absence of EGF. For all sequencing assays, cells were transferred to assay media 24 hours prior to sample collection. Assay media contains phenol red-free DMEM/F12 (1:1) supplemented with 1% charcoal-dextran stripped FBS (Fisher), 0.2 ng/ml EGF, 10 μg/ml insulin, 0.5 μg/mL hydrocortisone, and 100 ng/ml cholera toxin.

Miranda A.X., Kemp J., Davidson B., Bellomo S.E., Agan V., Manoni A., Marchiò C., Croessmann S., Park B.H, & Hodges E. (2024). Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutations. bioRxiv.

+ Open protocol

+ Expand

Culturing MCF-10A Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-10A parental cell lines were purchased from American Type Culture Collection (ATCC). MCF-10A cell line knock-ins were generated as previously described [15 (link)]. All cell lines were grown in 5% CO₂ at 37 °C with 1% Penicillin/Streptomycin in respective media conditions. Parental MCF-10A cell lines were cultured in DMEM/F12 (1:1) supplemented with 5% horse serum, 20 ng/ml epidermal growth factor (EGF), 10 µg/ml insulin (Roche), 0.5 µg/mL hydrocortisone (Sigma), and 100 ng/ml cholera toxin (Sigma). Knock-in cell lines were maintained in MCF-10A media in the absence of EGF. For all sequencing assays, cells were transferred to assay media 24 h prior to sample collection. Assay media contains phenol red-free DMEM/F12 (1:1) supplemented with 1% charcoal–dextran stripped FBS (Fisher), 0.2 ng/ml EGF, 10 µg/ml insulin, 0.5 µg/mL hydrocortisone, and 100 ng/ml cholera toxin.

Miranda A.X., Kemp J., Davidson B.A., Bellomo S.E., Miranda V.E., Manoni A., Marchiò C., Croessmann S., Park B.H, & Hodges E. (2024). Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutations. BMC Genomics, 25, 519.

+ Open protocol

+ Expand

Prostate Cancer Cell Line Maintenance and Androgen Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The VCaP and C4-2 cell lines were purchased from ATCC. All the cell lines were recently authenticated using short tandem repeat (STR) profiling by DDC Medical and tested for mycoplasma contamination (negative result) by using MycoAlert mycoplasma detection kit (Lonza). VCaP cells were cultured in DMEM medium with 10% FBS (fetal bovine serum, Gibco). VCaP-tet-shZBTB7A (tetracycline-inducible ZBTB7A silencing) cells were maintained in DMEM medium with 10% tetracycline-free FBS. C4-2 and C4-2-shZBTB7A (stable ZBTB7A silencing) cells were cultured in RPMI-1640 medium supplemented with 2% FBS plus 8% CSS (charcoal-dextran stripped FBS, Gibco). C4-2-tet-ZBTB7A (tetracycline-inducible ZBTB7A overexpressing) cells were maintained in RPMI-1640 medium with 2% tetracycline-free FBS plus 8% CSS. For androgen stimulation assays, cells were generally grown to 50-60% confluence in medium containing 5% CSS for 2-3 days (d) and then treated with DHT or inhibitors for indicated time.

Han D., Chen S., Han W., Gao S., Owiredu J.N., Li M., Balk S.P., He H.H, & Cai C. (2019). ZBTB7A Mediates the Transcriptional Repression Activity of the Androgen Receptor in Prostate Cancer. Cancer research, 79(20), 5260-5271.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!