Centricon 10 concentrator

Human colorectal cancer cell line Caco-2 and human normal hepatocyte cell line MIHA were cultured following the previous study [21 (link)]. In short, the culture medium was prepared based on MEM (for Caco-2) and DMEM (for MIHA) supplemented with 10% of FBS and 1% of penicillin and streptomycin. The cells were grown in an incubator with an atmosphere of 37 °C of temperature, 5% of CO₂, and humidity. To assess the effects upon treatment, the cells were incubated in serum-free media 24 h before the treatment.
For preparation of conditioned media (CM), Caco-2 cells (5 × 10⁵) were seeded in 100 mm culture dishes and treated with peptide (1 μg/mL) or/and GSK2033 (1 μM) in serum-free medium for 24 h following the previous study [22 (link)]. Subsequently, the medium was exchanged with fresh serum-free medium and collected as CM after 24 h. CM was concentrated 2-fold using a Centricon-10 concentrator (Millipore, Billerica, MA, USA) at 4 °C and filtered with 0.2 μm syringe filter. CM was treated to MIHA cells for further experiments.

Conditioned media from SH-SY5Y and N2a cells were prepared following the previous study^{58 (link)}. Cells were plated at a density of 5 × 10⁴ cells/mL in 100 mm culture dishes, incubated for 24 h, and then exposed to 2 Gy or 5 Gy of IR. At 2.5 days after irradiation, cells were washed with PBS three times, then further incubated in serum-free media without antibiotics for 36 h. CM were collected and centrifuged to remove any residual cells, after which they were filtered through a 0.2 μm syringe filter. Filtered CM was concentrated 10-fold using a Centricon-10 concentrator (Millipore, Billerica, MA) at 4 °C, then stored at −20 °C. Following CM collection, the number of cells on the dish was determined and the volume of CM used in each experiment was normalized for cell number.

Secretion of sICAM-1 in media was measured with ELISA method. Briefly, cells (6 × 10⁵) were seeded in 6-well plates and grown to 80% confluence. Following the transfection of specific siRNA and irradiation, the media was obtained and concentrated by 2-fold with Centricon-10 concentrator (Millipore, Billerica, MA, USA). Concentrated media were applied in an enzyme-linked immunoassay kit (Abcam), according to the manufacturer’s instructions.

To prepare substrates for DNA binding analysis, the 80-mer Oligo 1 (5′-TTATGTTCATTTTTTATATCCTTTACTTTATTTTCTCTGTTTATTCATTTACTTATTTTGTATTATCCTTATCTTATTTA-3′), Oligo 1 with its 3′ end labeled with Cy5, its exact complement Oligo 2 (5′-TAAATAAGATAAGGATAATACAAAATAAGTAAATGAATAAACAGAGAAAATAAAGTAAAGGATATAAAAAATGAACATAA-3′), and 80-mer poly-dT were synthesized and gel purified by Genomics BioSci & Tech. To prepare 80-mer duplex DNA, Oligo1 with or without 3′-Cy5 was incubated with Oligo 2 at 80 °C for 3 min, then at 65 °C for 30 min, followed by slow cooling to 23 °C for DNA annealing. The resulting duplex was purified from a 10% polyacrylamide gel by electro-elution and filter-dialyzed in a Centricon-10 concentrator (Millipore) at 4 °C into TE buffer (10 mM Tris-HCl, pH 8.0, and 0.5 mM EDTA). The 100-mer duplex (5′-AATATGATAGATAATGATAGTGATGAGGGACGTGGATCTCTTCTTACCTGCGGAGACGTCGAGGAGAACCCAGGACCAGGGGTACCTATGGCCTCCTCCG-3′) with or without 5′ biotin was synthesized by PCR and purified using the QIAquick^® PCR Purification kit (Qiagen). The supercoiled pBluescript II SK + plasmid was purified from E. coli by the plasmid midi kit (Qiagen). The linear form of pBluescript II SK + was prepared by digestion of the supercoiled DNA with EcoRV and purified using the QIAquick^® PCR Purification kit (Qiagen).

Cells were plated at a density of 1 × 10⁸ cells/mL in 150-mm culture dishes, incubated for 24 h, and then exposed to 6 Gy of IR. At 24 h after irradiation and transfection of PAI-1 siRNA, cells were washed with PBS three times, then further incubated in serum-free media without antibiotics for 48 h. CM were collected and filtered through a 0.45 μm syringe filter to remove any residual cells. Filtered CM was concentrated 10-fold using a Centricon-10 concentrator (Millipore, Billerica, MA, USA) at 4 °C, then stored at −20 °C. Following CM collection, the number of cells on the dish was determined and the volume of CM used in each experiment was normalized for cell number.