Abi 7500 fast thermocycler

TRIzol reagent (Takara Biotechnology Co. Ltd., Dalian, China) was used to extract total RNA from cells in all groups. Afterwards, the PrimeScript RT reagent kit equipped with gDNA Eraser (Takara Biotechnology Co., Ltd.) was utilized to synthesize cDNA through reverse transcription of RNA. The ABI 7500 Fast thermocycler (Applied Biosystems, Foster City, CA, USA) was employed for PCR amplification using SYBR-Green PCR kit (TransGen Biotech Co., Ltd., Beijing, China). Following were the PCR amplification conditions: 10 min at 95°C, then 15 s at 95°C for 40 cycles, and 45 s at 60°C for annealing/extension. Shanghai Sangon (Shanghai, China) was responsible for primer design. The sequences of specific primers for all genes are as follows: for miR-200b-3p: 5′-TAATACTGCCTGGTAATGATG-3′ and 5′-CTCAACTGGTGTCGTGGA-3′; for miR-200c-3p: 5′-TAATACTGCCGGGTAATGATGG-3′ and 5′-CCTCAACTGGTGTCGTGGA-3′; for miR-429-3p: 5′-TAATACTGTCTGGTAATGCCG-3′ and 5′-CTCAACTGGTGTCGTGGA-3′, and for U6: 5′-CTCGCTTCGGCAGCACA-3′ and 5′-AACGCTTCACGAATTTGCGT-3′. Typically, gene expression was normalized relative to U6 and quantified by the 2^−∆∆Ct = [(C_Tgene of interest-C_Tinternal control)sample A-(C_Tgene of interest-C_Tinternal control)sample B].

In order to discriminate Xap from other atypical X. arboricola strains present in Prunus spp., a partial sequence of the xopE3 gene that is encoded on the pXap41 plasmid, described as specific for Xap (Pothier et al., 2011b (link)), was used. Sequences of the xopE3 gene available in GenBank database from strains CITA 33 (GenBank locus tag DK27_00095), IVIA 2626.1 (AN652_04270), MAFF 301420 (XPR_2580), MAFF 301427 (XPN_1257) and CFBP 5530 (XAP_pXAP410005) were aligned with ClustalW and the consensus sequence used as template for xopE3 primers and probe design using the ABI PRISM Primer Express software v. 2 (Applied Biosystems, Foster City, CA). Specificity of the primers was firstly evaluated in silico using the Primer-BLAST tool available at NCBI. Graphical representation of the primers and the probe hybridization was performed in a set of X. arboricola genome sequences using the BRIG software.
Real-time PCR was conducted in a total volume of 25 μl containing, 12.5 μl of GoTaq probe qPCR MasterMix (Promega, Madison, WI, USA), 0.4 μM of each primer, 150 nM of TaqMan probe, and 5 μl of sample. Real-time PCR amplifications were performed in an ABI 7,500 Fast thermocycler (Applied Biosystems, Foster city, CA) and consisted of an initial denaturation step of 95°C for 5 min followed by 45 cycles, each one of 1 min at 95°C and 1 min at 59°C.

Fly and fibroblast RNA were extracted with Quick‐RNA MiniPrep (Genesee Scientific, Cat #: 11‐328) according to the protocol provided by the manufacturer. cDNA was prepared by reverse transcription of total RNA with a High‐Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA, Ref #: 4368814). Q‐PCR was performed with an ABI 7500 Fast thermocycler (Applied Biosystems, Ref #: 4368813) following protocols provided by the manufacturer. Triplicates were processed for each gene/sample combination. The primers were listed as following. Relish forward: 5′‐GGCATCATACACACCGCCAAGAAG‐3′, Relish reverse: 5′‐GTAGCTGTTTGTGGGACAACTCGC‐3′, Diptericin forward: 5′‐ATTGGACTGAATGGAGGATATGG‐3′, Diptericin reverse: 5′‐CGGAAATCTGTAGGTGTAGGT‐3′, Eiger forward: 5′‐CTGCCGAGACCCTCAAGC‐3′, Eiger reverse: 5′‐AGATCGTTAGTGCGAGAATG‐3′, D‐GAPDH forward: 5′‐AAGGGAATCCTGGGCTACAC‐3′, D‐GAPDH reverse: 5′‐CGGTTGGAGTAACCGAACTC‐3′, IL‐6 forward: 5′‐TACCCCCAGGAGAAGATTCC‐3′, IL‐6 reverse: 5′‐TTTTCTGCCAGTGCCTCTTT‐3′, IL‐8 forward: 5′‐GTGCAGTTTTGCCAAGGAGT‐3′, IL‐8 reverse: 5′‐CTCTGCACCCAGTTTTCCTT‐3′, RPL13A forward: 5′‐GTACGCTGTGAAGGCATCAA‐3′, RPL13A reverse: 5′‐CGCTTTTTCTTGTCGTAGGG‐3′, hAAT forward: 5′‐CTGAATTTCAACCTCACGGAGAT‐3′, hAAT reverse: 5′‐GGTTGAGGGTACGGAGGAGTT‐3′.

RNA was isolated from tissues or cells using a mirVana miRNA Isolation Kit (Ambion, Carlsbad, CA, USA) in accordance with the manufacturer's instructions. First-strand cDNA was synthesized using a PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Dalian, China). The extraction concentration was measured with a NanoDrop spectrophotometer (Thermo Fisher, San Jose, CA, USA); the samples were preserved at −80 °C. The cDNA was amplified using Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA) with appropriate primers and with an ABI 7500-fast thermocycler (Applied Biosystems, Foster City, CA, USA). The primers used were as follows (forward and reverse, respectively): 5′GCGAGTGTGCTGGTCACTAA′3 and ACAATTGGCCGCTAAACTTG’3 to detect TOP2A mRNA as well as 5′TGCACCACCAACTGCTTAGC′3 and 5’GGCATGGACTGTGGTCATGAG′3 to detect GAPDH. In addition, primers for miR-144-3p and U6 were purchased from Tiangen. U6 and GAPDH served as internal controls, and the relative expression was determined using the 2^−∆∆Ct method.

Total RNA was extracted from 3T3-L1 cells with an RNeasy mini kit (Qiagen, Hilden, Germany). Reverse transcription was performed with total RNA (100–200 ng) and the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Quantitative PCR was performed on an ABI 7500 Fast thermocycler (Applied Biosystems) with the TaqMan gene expression assay system (C/EBPδ, Mm00786711_s1; PPARγ, Mm00440940_m1).

Using the Qiagen RNeasy micro kit (Qiagen), total RNA was isolated from LSK cells from poly(I:C)-treated Mx1-Cre Meis1^fl/fl and sham-treated Meis1^fl/fl mice (pools of six mice; two pools per genotype). Total RNAs were reverse transcribed using a SuperScript VILO cDNA Synthesis System (Invitrogen, Carlsbad, CA). Real-time RT-PCR was performed with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and ABI 7500 Fast thermocycler (Applied Biosystems), according to the manufacturer's protocol. Amplification of β-actin was used to normalize for sample RNA content. Specificity of products was confirmed by melting curve analysis, assessing band size in 2% agarose gels, and DNA sequencing. The primer sequences used for RT-PCR and qPCR are listed in Table S2.