Steponeplus real time pcr machine

Total DNA was extracted from cell lysates or culture supernatants using the GenElute mammalian genomic DNA extraction kit (Sigma Aldrich, US) and following the ‘cell lysates’ manufacturer’s protocols. Total DNA was extracted from tumour and tissue homogenates using the DNeasy Blood and Tissue kit (Qiagen, UK) according to the manufacturer’s protocol. For assessing viral genomes, a six point, tenfold standard curve was generated using enadenotucirev virus particles spanning 2.5x10³vp to 2.5x10⁸vp spiked into the relevant assay matrix. The primers and probe were as follows; forward primer: 5’–ATCCATGTCTAGACTTCGACCCAG– 3’, reverse primer: 5’—TGCTGGGTGATAACTATGGGGT– 3’ Probe: 5’—FAM-ATCTGTGGAGTTCATCGCCTCTCTTACG-TAMRA– 3’. For analysing A549 cells human specific sequences targeting the human prostaglandin E receptor 2 (PTGER2) gene region were used. This primer probes set has been previously characterised in Alcoser et al [42 (link)] and allow quantification of human tissue in murine xenograft models. DNA samples were analysed on the StepOne Plus Real time PCR machine (Thermo Fisher Scientific) in a 10μL reaction volume containing 2μL of DNA, 8μL of Taqman Fast advance reaction mix, 80nM of each primer and 20nM of probe. The initial denaturation step at 95°C for 20 sec was followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds.

Total RNA was extracted from GFP+ and GFP, CD49f+ and CD49f–, control and cisplatin treated cells using RNeasy kit (Qiagen). For mRNA analysis, cDNA was synthesized from 1 ug of total RNA using the Superscript III kit (Invitrogen, Grand Island, NY). SYBR Green-based real time PCR was subsequently performed in triplicate using SYBR-Green master mix (SA Biosciences) on Applied Biosystems StepOnePlus real time PCR machine (Thermo). For analysis, the threshold cycle (Ct) values for each gene were normalized to expression levels of β-actin. The primers used were:

Total RNA was extracted from CSCs and non-CSCs, CD55 knockdown and overexpressing cells and their respective controls, saracatinib-treated cells, and LCK-overexpressing cells using the RNeasy kit (QIAGEN). For mRNA analysis, cDNA was synthesized from 1 μg total RNA using the Superscript III kit (Invitrogen). SYBR Green-based real-time PCR was subsequently performed in triplicate using SYBR-Green master mix (SA Biosciences) on an Applied Biosystems StepOnePlus real-time PCR machine (Thermo Fisher Scientific). For analysis, the threshold cycle (Ct) values for each gene were normalized to expression levels of β-actin. The primers used are listed in Table 1.

RNA was extracted from cells by directly adding TRIzol (Thermo Fisher) to wells containing cells, or using the ReliaPrep RNA MiniPrep system (Promega), each according to the manufacturer's instructions. In the case of TRIzol-based extractions, nucleic acid was treated with Turbo DNase (Thermo Fisher) then RNA re-extracted with phenol/chloroform/isoamyl alcohol and chloroform extraction. Reverse transcription was performed with Super Script III Reverse Transcriptase (Thermo Fisher) using a combination of anchored oligo dT and random hexamers. Depending on the input material amount, cDNA was then diluted within a range of 1:10 to 1:50 then used for qPCR analysis with PowerUp SYBR Green Master Mix (Thermo Fisher) on a StepOnePlus Real-Time PCR machine (Thermo Fisher). For standard PCR, cDNA was added and amplified using Taq 2X Master Mix (NEB) with cycle number determined empirically to ensure no overamplification. PCR products were analyzed by either agarose gel or DNA1000 BioAnalyzer chip (Agilent) run on the 2100 BioAnalyzer (Agilent).

qPCR was performed with the Sso Advanced Universal SYBR Green Supermix kit from Bio-Rad (El Prat del Llobregat, Spain) in an Applied Biosystems StepOnePlus Real-Time PCR Machine from Thermo Fisher Scientific (Waltham, MA, USA). Commercial primer pairs were used for CDH2 and SOX9, as well as B2M and RPL24 all from Bio-Rad (El Prat del Llobregat, Spain) as housekeeping genes. To prevent gDNA amplification, a DNase digestion step was included during RNA extraction, and intron-spanning primer pairs were selected. The amplification program consisted of an initial activation step of 30 s at 95 °C, followed by 50 cycles of 10 s at 95 °C for denaturation and 1 min at 60 °C for annealing and extension and a final denaturation step of 15 s at 95 °C. Melt curves were performed from 65 °C to 95 °C in steps of 0.5 °C. Technical duplicates of each sample were performed in the qPCR.
qPCR data was analyzed with qBase+ software version 3.1 from Biogazelle (Zwijnaarde, Belgium). Expression of each gene was calculated by the 2−ΔΔCt method, normalized to that of S₀ substrates (assigned value 1) and presented as relative mRNA expression levels.