Cdna synthesis kit

Manufactured by Yeasen

Sourced in China

The cDNA Synthesis Kit is a laboratory equipment designed for the reverse transcription of RNA to complementary DNA (cDNA). It provides the necessary reagents and enzymes to efficiently convert RNA into single-stranded cDNA, which can then be used for various downstream applications, such as gene expression analysis, cloning, or sequencing.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (13 mentions) Sybr green master mix, by Yeasen (9 mentions) Qpcr sybr green master mix, by Yeasen (6 mentions) Trizol, by Thermo Fisher Scientific (5 mentions) Sybr green pcr kit, by Yeasen (3 mentions) Sybr green kit, by Yeasen (3 mentions) Trizol reagent, by Vazyme (2 mentions) Hieff qpcr sybr green master mix, by Yeasen (2 mentions) Trizol, by Takara Bio (2 mentions) Quantstudio 5, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Takara Bio (2 mentions) Rt qpcr kit, by Yeasen (2 mentions) Hieff unicon universal blue qpcr sybr green master mix, by Yeasen (2 mentions) Trnzol reagent, by Tiangen Biotech (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Lightcycler 480, by Roche (2 mentions) Nanodrop 1000, by Thermo Fisher Scientific (2 mentions) Sybr green master mix reagent, by Yeasen (1 mentions)

61 protocols using cdna synthesis kit

Oxalate-Induced Kidney Cell Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols

The normal rat kidney proximal tubular epithelial cell line (NRK-52E) was obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s modified eagle medium (DMEM; Hyclone, USA) with 10% fetal bovine serum (FBS; Gibco, USA) at 37°C in a humidified atmosphere with 5% CO₂. The normal human kidney proximal tubular epithelial cell line (HK-2) was purchased from Procell (Wuhan, China) and cultured in DMEM-F12 medium (Hyclone, USA) with 10% FBS at 37°C in a humidified atmosphere with 5% CO2. NRK-52E and HK-2 cells were treated with oxalate (1 mmol/L) for 24 h, and cells without treatments were used as a control group.
Total RNA was extracted using a TRIzol reagent (Vazyme, Nanjing, China). Then, the purified RNA was reverse-transcribed into cDNA using a cDNA synthesis kit (Yeasen, Shanghai, China). Next, real-time quantitative polymerase chain reaction (RT-qPCR) was performed using SYBR Green Master Mix reagent (Yeasen, Shanghai, China) on the PCR System. The mRNA expression levels of genes were calculated using the 2^-ΔΔCt method. The sequences of primers used in this study were presented in Table 1.

Hong S.Y., Jiang H.C., Xu W.C., Zeng H.S., Wang S.G, & Qin B.L. (2023). Bioinformatics analysis reveals the potential role of matrix metalloproteinases in immunity and urolithiasis. Frontiers in Immunology, 14, 1158379.

+ Open protocol

+ Expand

Transcriptional Profiling of Hypoxia Markers

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with Trizol Reagent (Ambion, cat.: 15,596,018). The purified RNA was treated with DNase to avoid DNA contamination. The cDNA was prepared by reverse transcription using a cDNA synthesis kit (Yeasen, cat.: 11119ES60). The cDNA was used as the template for RT-qPCR (Hieff® qPCR SYBR Green Master Mix; Yeasen; cat.: 11202ES08) and GAPDH mRNA was used for internal control [22 (link)]. The primers for RT-qPCR were listed as follows: HIF-1α forward, 5’-CTACCACTGCCACCACTGAT-3’ and reverse, 5’-TGCTCCATTCCATTCTGTTCAC-3’; STAT3 forward, 5’-AGTTCTCCTCCACCACCAAG-3’ and reverse, 5’-GTCTTACCGCTGATGTCCTTC-3’; VEGFA forward, 5’-CTTGCTGCTCTACCTCCACCAT-3’ and reverse, 5’-ACACGCTCCAGGACTTATACCG-3’; GAPDH forward, 5’-TGGCCTCCAAGGAGTAAGAAAC-3’. The manufacturer of PCR instrument is ABI (ABI 7500).

Kong L., Li J., Yang Y., Tang H, & Zou H. (2022). Paeoniflorin alleviates the progression of retinal vein occlusion via inhibiting hypoxia inducible factor-1α/vascular endothelial growth factor/STAT3 pathway. Bioengineered, 13(5), 13622-13631.

+ Open protocol

+ Expand

Anti-inflammatory Effects of HEP-Ag-BSA on LPS-Induced IBMDM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

IBMDM cells were cultured in 6‐well plates. LPS at 1 µg mL⁻¹ was used to stimulate the cells. Leach liquor of HEP‐Ag‐BSA was added to cell culture to test its anti‐inflammation property. After 6 h of stimulation, the total RNA of cells was extracted using Trizol (Takara, Japan). After that, a cDNA Synthesis Kit (Yeasen, China) was applied to transcribe extracted RNA into cDNA. Then, RT‐qPCR was performed for semi‐quantification of the expression level of certain factors related to inflammation.
Here listed the primer sequences:
IL‐1β: Forward TTCAGGCAGGCAGTATCACTC
Reverse GAAGGTCCACGGGAAAGACAC
IL‐6: Forward CTGCAAGAGACTTCCATCCAG
Reverse AGTGGTATAGACAGGTCTGTTGG
β‐actin: Forward CGTTGACATCCGTAAAGACC
Reverse TAGGAGCCAGAGCAGTAATC
TNF‐α 1: Forward CAGGCGGTGCCTATGTCTC
Reverse CGATCACCCCGAAGTTCAGTAG

Hong L., Chen G., Cai Z., Liu H., Zhang C., Wang F., Xiao Z., Zhong J., Wang L., Wang Z, & Cui W. (2022). Balancing Microthrombosis and Inflammation via Injectable Protein Hydrogel for Inflammatory Bowel Disease. Advanced Science, 9(20), 2200281.

+ Open protocol

+ Expand

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (Invitrogen) and reverse transcribed with a cDNA synthesis kit (Yeasen Biotechnology Co., Ltd, Shanghai, China) following the manufacturer's instructions. The resulting cDNAs were then amplified through qPCR with the addition of SYBR Green Master Mix (Yeasen) in a Light Cycler Real-Time PCR instrument (Roche, Basel, Switzerland) following the specifications provided by the manufacturer. QPCR was conducted under the following conditions: a 5 min period at 95°C, followed by 35 cycles of 30 sec at 95°C, 30 sec at 58°C, 30 sec at 72°C, and a 10 min extension at 72°C. Gene expression changes were normalized to Actb and analyzed by the 2^−ΔΔCt method. The primer sequences can be found in Table S1.

Zhang H., Li H., Yao J., Zhao M, & Zhang C. (2024). The mutation of NSUN5 R295C promotes preeclampsia by impairing decidualization through downregulating IL-11Rα. iScience, 27(2), 108899.

+ Open protocol

+ Expand

Comprehensive Gene Expression Analysis by RT-qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the TRIzol reagent following the standard instructions. The purified RNA was treated with DNase to remove DNA contamination and the first strand of cDNA was synthesized using a cDNA synthesis kit (11123ES60, Yeasen, China). The synthesized cDNA was used as a template for qRT-PCR using the SYBR-Green Real-Time PCR Master Mix (11202ES08, Yeasen, China). GAPDH was utilized as the internal reference gene for normalization of target gene expression. The RT-qPCR primers are listed in Table 1.17 (link)

Table 1

Primer Sequences

Name		Primer Sequences
Ki67	Forward	5’-AAACCCCACCAAGTAAAACA-3’
Ki67	Reverse	5’-CCAAGGCAAGCTCAGGAC-3’
GPX4	Forward	5’-AGTGGATGAAGATCCAACCCAAGG-3’
GPX4	Reverse	5’-GGGCCACACACTTGTGGAGCTAGA3’
PTGS2	Forward	5’-TGACCAGAGCAGGCAGATGA-3’
PTGS2	Reverse	5’-CCAGTAGGCAGGAGAACATATAACA-3’
SLC7A11	Forward	5’-GTCTGGAGAAACAGCCAAGG-3’
SLC7A11	Reverse	5’-CGGAGTTCCTCGAATAGCTG-3’
ACSL4	Forward	5’-GTAATTGGTGGACAGAACATC-3’
ACSL4	Reverse	5’-TACTCTCCTGCTTGTAACTTC-3’
GAPDH	Forward	5’-AAAGAAGCTCAACTACATGG-3’
GAPDH	Reverse	5’-TGCAAAGAATGCGTCCCAGAG-3’

Yin X., Yang Q., Li H., Kang Y, & Li Z. (2023). Vancomycin Induced Ferroptosis in Renal Injury Through the Inactivation of Recombinant Glutathione Peroxidase 4 and the Accumulation of Peroxides. Drug Design, Development and Therapy, 17, 283-295.

+ Open protocol

+ Expand

Total RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cell lines or frozen tissue using TRIzol reagent (Genestar, Shanghai, China) according to the manufacturer’s instructions. RNA sample concentrations were measured using Spectrophotometer (DeNovix, United States) spectrophotometrically. Complementary DNA (cDNA) was synthesized by cDNA Synthesis Kit (Yeasen, Shanghai, China) according to the manufacturer’s instructions. qRT-PCR was performed using the SYBR Green PCR kit (Yeasen, Shanghai, China). The three-step method was applied as the amplification procedure. First, pre-denatured at 95°C for 5 min. Then denatured at 95°C for 10 s, annealed at 55–60°C for 20 s, and extended at 72°C for 20 s, this step requires 40 cycles. The default setting of the instrument was adopted for the melting curve stage. The primers are listed in Table S3. All qRT-PCR reactions for each sample were performed in triplicate, using the IQ5 multicolor qRT-PCR detection system (Bio-Rad, United States). GAPDH were used as control for messenger RNA (mRNA). The 2^−ΔΔCt method was utilized for the qRT-PCR analysis.

Jiang Q., Zhang J., Li F., Ma X., Wu F., Miao J., Li Q., Wang X., Sun R., Yang Y., Zhao L, & Huang C. (2021). POLR2A Promotes the Proliferation of Gastric Cancer Cells by Advancing the Overall Cell Cycle Progression. Frontiers in Genetics, 12, 688575.

+ Open protocol

+ Expand

Total RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the tissues and cell lines was extracted by a Total RNA Extraction Reagent kit (10606ES60, Yeasen, Shanghai, China) according to standard protocols. Then, a cDNA synthesis kit (11139ES10, Yeasen, Shanghai, China) was used for reverse transcription. Gene expression was quantified by a Roche LightCycler 480 machine via SYBR Green Master Mix (11201ES03, Yeasen, Shanghai, China). The expression levels were calculated based on a semiquantitative method following the formula 2^−ΔΔct. We chose GAPDH as the internal reference for normalization. All primers involved in this experiment were synthesized by Tsingke Biotech (Tsingke, Beijing, China). All the primers are listed in Supplementary Table S1.

Wu Z., Zhang F., Wang Y., Lu Z, & Lin C. (2022). Identification and Validation of the lncRNA MYOSLID as a Regulating Factor of Necroptosis and Immune Cell Infiltration in Colorectal Cancer following Necroptosis-Related LncRNA Model Establishment. Cancers, 14(18), 4364.

+ Open protocol

+ Expand

LINC01315 Expression in Colorectal Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of LINC01315 in SW480 cells and HCT116 cells, CD133⁺/CD44⁺ SW480 cells, and CD133⁺/CD44⁺ HCT116 cells, and exosomes isolated from SW480 and HCT116 cells was quantified through qRT-PCR. In brief, the total RNA in the above-mentioned samples was isolated using a total RNA extraction kit (19201ES60, Yeasen, Shanghai, China). After the concentration of isolated RNA was detected using a UV spectrophotometer (NanoDrop, Thermo Scientific), the cDNA was synthesized using the RNA with the help of a cDNA synthesis kit (11119ES60, Yeasen). The cDNA was subsequently mixed with SYBR Green Master Mix (11203ES03, Yeasen), and amplified using QuantStudio 7 System (Applied Biosystems, Waltham, Massachusetts, USA) under the following condition: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s (s); annealing at 56°C for 20 s; elongation at 72°C for 20 s. The process from denaturation to elongation was repeated for 40 cycles. The sequences of forward (F) and reverse (R) primers were listed below: LINC01315 (F: 5'-ACATTGAGCCTGCTCCTGTC-3', R: 5'-TTTCCGGTAGGGGGAAAACG-3'); glyceraldehyde-3-phosphate dehydrogenase (GAPDH; F: 5'-GGGCTGCTTTTAACTCTGGT-3', R: 5'-GCAGGTTTTTCTAGACGG-3').

Li Y., Wu M., Xu S., Huang H., Yan L, & Gu Y. (2022). Colorectal cancer stem cell-derived exosomal long intergenic noncoding RNA 01315 (LINC01315) promotes proliferation, migration, and stemness of colorectal cancer cells. Bioengineered, 13(4), 10827-10842.

+ Open protocol

+ Expand

Extracting and Quantifying Transcripts from GBM

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from GBM tissues and cell lines using Trizol RNA isolation reagent (Invitrogen) and reversely transcribed to cDNA with a cDNA Synthesis kit (Yeasen Biotech Co., Shanghai, China). qRT-PCR was used to detect the gene expressions with Hieff^® qPCR SYBR Green Master Mix (Low Rox Plus) (Yeasen Biotech Co. China). The sequences of primers are shown in Supplementary Table S2.

Liu X., Huang Y., Qi Y., Wu S., Hu F., Wang J., Shu K., Zhang H., Bartsch J.W., Nimsky C., Dong F, & Lei T. (2022). The GBM Tumor Microenvironment as a Modulator of Therapy Response: ADAM8 Causes Tumor Infiltration of Tams through HB-EGF/EGFR-Mediated CCL2 Expression and Overcomes TMZ Chemosensitization in Glioblastoma. Cancers, 14(19), 4910.

+ Open protocol

+ Expand

Quantifying LOXL1-AS1 Expression by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by using TRIzol reagent (Invitrogen, Thermo Fisher Scienti c, Inc.). The quantity of total RNA was measured by using NanoDrop equipment (Thermo Fisher Scienti c, Waltham, Massachusetts, USA) according to the manufacturer's instructions.
Complementary DNA (cDNA) was synthesized using a cDNA synthesis kit (Yeasen, Shanghai, China). qPCR was performed using the SYBR Green PCR Master Mix (Yeasen, Shanghai, China). All target genes were normalized to the endogenous reference gene GAPDH by using an optimized comparative Ct (2-ΔΔCt) value method. qPCR assay was performed on the 7500 Fast qPCR system using a One-Step SYBR PrimeScript RT-PCR kit (Applied Biosystems, Foster City, California, USA). The speci c primer sequences of LOXL1-AS1 and GAPDH were as follows: LOXL1-AS1 forward primer: GGTGCCACGGCTTACCAA LOXL1-AS1 reverse primer: TCCTATCCCTGCCATTCCCA GAPDH forward primer: GAAGGTGAAGGTCGGAGTC GAPDH reverse primer: GAAGATGGTGATGGGATTTC
The relative gene expression was quanti ed using the 2-ΔΔCtmethod.

Maher H., Pan Y., Kwabena G.O., Zhang B., Wang Y., Lv J., & Cai X. (2021). A Novelty of Long Non-coding RNA LOXL1-AS1: Suppresses Tumor Progression and Metastasis and an Independent Favorable Prognostic Factor in Hepatocellular Carcinoma.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!