Quantitative real-time PCR (qRT-PCR) was performed to analyze the expression of the transgenes. Total RNA was extracted from grains and leaves collected 18 days after flowering from T2-generation plants. Grain RNA was extracted as described by Singh et al.44 , and leaf RNA was extracted using Trizol® reagent (Invitrogen, USA). RNA was treated with DNase I (Thermo Fisher Scientific, Inc., USA) to eliminate genomic DNA. The RevertAidTM first strand cDNA synthesis kit (Thermo Fisher Scientific, Inc., USA) was used for cDNA synthesis. qRT-PCR was performed on the LightCycler® 480 Instrument (Roche, Switzerland). The total reaction volume of 10 μl included 1 μl cDNA, 0.2 μl forward primer, 0.2 μl reverse primer, 5 μl Sybrgreen Mastermix (Applied Biosystems, Ltd., USA), and 3.6 μl H2O. Primers were designed using a CLC genomics workbench (Supplementary Table S3 ). The Ct value was obtained from LightCycler® 480 Instrument (Roche, Switzerland). Os01g0147200 encoding IWS1, C-terminal family protein was used as a reference gene for data normalization. The data normalization was done as described by Liu et al.45 (link).
Lightcycler 480 instrument
Manufactured by Roche
Sourced in Germany, Switzerland, United States, China, Japan, France, Italy, Canada, Netherlands, United Kingdom, Belgium, Spain, Portugal
The LightCycler 480 Instrument is a real-time PCR system designed for quantitative and qualitative nucleic acid analysis. It features a 96-well or 384-well microplate format and uses optical detection technology to monitor fluorescence signals during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (111 mentions)
Rneasy mini kit, by Qiagen (50 mentions)
Trizol, by Thermo Fisher Scientific (32 mentions)
Lightcycler 480 sybr green 1 master mix, by Roche (31 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (29 mentions)
Lightcycler 480 sybr green 1 master, by Roche (28 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (28 mentions)
Lightcycler 480, by Roche (25 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (23 mentions)
Primescript rt reagent kit, by Takara Bio (19 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (17 mentions)
Nanodrop, by Thermo Fisher Scientific (16 mentions)
Lightcycler 480 sybr green 1 master kit, by Roche (15 mentions)
Sybr green 1 master mix, by Roche (15 mentions)
Dnase 1, by Thermo Fisher Scientific (14 mentions)
Iscript cdna synthesis kit, by Bio-Rad (14 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (13 mentions)
Quantitect reverse transcription kit, by Qiagen (13 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (13 mentions)
Sybr green pcr master mix, by Roche (12 mentions)
673 protocols using lightcycler 480 instrument
1
Quantitative Analysis of Transgene Expression in Rice
2
Quantitative RT-PCR for mRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each sample of total RNA was isolated from five normally developed terminal oocytes or resorption body 1 oocytes per female adult respectively as one biological replicate using TRIzol reagent (Invitrogen). For mRNA quantification, Oligo (dT)-primed cDNA was reverse transcribed from total RNA using Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega). qRT-PCR was carried out using a LightCycler 480 instrument (Roche) and Talent qPCR PreMix (SYBR Green) (Tiangen) according to the manufacturer’s instructions. For miRNA quantification, the miRcute Plus miRNA First-Strand cDNA Synthesis Kit (Tiangen) was used to synthesize the cDNA. The cDNA of miRNA was subjected to qRT-PCR using the miRcute Plus miRNA qPCR Detection Kit (SYBR Green) (Tiangen) according to the manufacturer’s instructions on a LightCycler 480 instrument (Roche). The PCR data were analyzed by the 2-△△Ct method of relative quantification with the internal control rp49 and U6 for mRNA and miRNA, respectively. All the primers for qRT-PCR are listed in S1 Table .
3
Quantifying lipA Transcription in ZS6 Growth
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate changes of lipA transcription levels during ZS6 growth in MS medium supplemented with 2% olive oil, quantitative reverse transcription PCR (qRT-PCR) assay using primers ZS6-lipA-RTF (5′-GCACCACAAGAGTCCGCTAC-3′) and ZS6-lipA-RTR (5′-TTCAATACCCGCATCAATCC-3′) was performed, in which transcription of rplU with primers (rplU-F, 5′-GTGGTAAACAACACCGAGTAAG-3′; rplU-R, 5′-CAACGAAAGGAACGCCGATT-3′) in ZS6 was used as reference (Petersen and Tisa 2014 (link)). qRT-PCR was performed as follows: total RNA of 500 ng was used for the first strand cDNA synthesis with PrimeScript RT reagent kit plus gDNA Eraser (Takara Bio Inc., Tokyo, Japan) according to manufacturer’s protocol. The resulting cDNA was tenfold diluted and subjected to quantitative PCR using SYBR Premix Ex Taq II kit (Takara Bio Inc.) on a Roche LightCycler 480 instrument (Roche, Basel, Switzerland) with the condition as follows: initial denaturing for 30 s at 95 °C, followed by 40 cycles of 5 s at 95 °C and 30 s at 58 °C.
4
RNA Extraction and qPCR Analysis of Adipose and Hypothalamic Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
QIAzol Lysis Reagent (QIAGEN GmbH, Hilden, Germany) was used for tissue lysis. The total RNA content was isolated from homogenized adipose and hypothalamic tissue by using the RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) including on-column DNaseI treatment. RNA quantity was measured on NanoDrop (NanoDrop 2000c, ThermoFisherScientific GmbH, Vienna, Austria) and 1 μg total RNA was reverse transcribed to cDNA by using the iScript advanced cDNA synthesis kit (Bio-Rad Laboratories, Vienna, Austria). Gene expression analysis via quantitative PCR was performed using TaqMan Universal PCR Master Mix (Life Technologies, Carlsbad, CA, USA) or LightCycler 480 SYBR Green I Master Mix (Roche, Vienna, Austria) according to the manufacturer’s instructions on a Roche LightCycler 480 Instrument (Roche Austria, Vienna, Austria). The sequences of primers and probes are listed in the Supplementary Material .
5
mRNA Expression Analysis in PDAC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of mRNA expression, total RNA was extracted from PDAC cells using trizol reagent and purified through digestion with DNase I for 15 min. RNA was recovered using the RNeasy Kit (Qiagen, Germany). Reverse transcription of 1 µg purified RNA was conducted in a 20 µL reverse transcription system for 15 min at 37°C according to the manufacturer’s protocol. Gli1, NF-κB, Shh, KRAS, and GAPDH Taqman primers were purchased from Invitrogen (Shanghai Life Technologies Biotechnology Co., Ltd.). For quantitative PCR (qPCR), 20 μL mixture reactions including gene-specific taqman primers were run the Roche LightCycler® 480 instrument (Roche, Switzerland). The amount of each target gene in a given sample was normalized to the level of GAPDH in that sample. All experiments were run in triplicate.
6
Quantifying miR-3650 Expression in Hepatocellular Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from fresh-frozen tissues and HCC cells using TRIzol reagent (Invitrogen, NY, USA) as per the manufacturer’s instructions. The quantity of RNA samples was measured by a NanoDropTM 1000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). 1 μg total RNA and All-in-oneTM First-Strand cDNA Synthesis Kit (GeneCopoeia, Rockville, USA) were used to generate cDNA, which was subjected to RT-PCR using All-in-One™ miRNA qRT-PCR Detection Kit (Gene-Copoeia, Carlsbad, CA, USA). PCR was performed on a Roche Light Cycler 480 instrument (Roche, Basel, Switzerland) according to a standard method as described previously [30 (link)]. The relative expression of miR-3650 was calculated using the 2−ΔΔCt method and U6 was used as the endogenous control. The primer sequences used in this study are shown in supplementary Table S1.
7
Quantitative Gene Expression Analysis in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was prepared from the livers of study mice and quantified using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Equivalent concentrations of RNA samples were prepared and converted to cDNA. The obtained cDNA was mixed with LightCycler® 480 SYBR Green Mastermix (Invitrogen, CA, USA) and the primer set for the individual gene of interest. The primer blast program was used for customized oligo designs that were used in the current study and the designs are shown in Table 1 . RT-PCR reactions were performed in a Roche LightCycler 480 Instrument (Roche Applied Science, Rotkreuz, Switzerland), and the obtained Ct values were normalized to the Ct value of glyceraldehyde-3-phosphate dehydrogenase (GAPDH)—the housekeeping gene control. The results were further analyzed by the 2–Ct method and the results of that analysis represent data from at least 6 mice/group.
8
Genistein Modulates TRAIL Expression in INS-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
INS-1 cells were cultured with 0.1 µM dexamethasone in the absence or presence of 10 μM genistein for 48 h. The total RNA of INS-1 cells was extracted using a High Pure RNA Isolation Kit (Roche Diagnostics, Basel, Switzerland). RNA concentration was measured using a NanoDrop (ND)-1000 Spectrophotometer (NanoDrop Technologies LLC, Wilmington, DE, USA). Reverse transcription was performed using 1 μg of RNA and a reagent from a SuperScript III Reverse Transcription Kit with random hexamer primer (Invitrogen Corporation, Carlsbad, CA, USA). Real-time RT-qPCR was then performed using SYBR Green.
Reaction Mix and a Roche LightCycler 480 Instrument (Roche Diagnostics). A pair of specific primers for rat TRAIL included forward primer: 5′ TGATGAAGAGTGCCAGAAAATAGC 3′ and reverse primer: 5′ CCAGGTCCATCAAATGCTCA 3′. The primers used for rat β-actin were forward primer: 5′ ATGAAGTGACGTTGACA 3′ and reverse primer: 5′ CCTGAAGCATTTGCGGTGCACGATG 3′. The threshold cycles (Ct) of TRAIL and β-actin genes were measured, and the difference between their ∆Ct was calculated. Relative expression was then calculated using the 2-∆∆Ct method, and the results was compared to that of the control group.
Reaction Mix and a Roche LightCycler 480 Instrument (Roche Diagnostics). A pair of specific primers for rat TRAIL included forward primer: 5′ TGATGAAGAGTGCCAGAAAATAGC 3′ and reverse primer: 5′ CCAGGTCCATCAAATGCTCA 3′. The primers used for rat β-actin were forward primer: 5′ ATGAAGTGACGTTGACA 3′ and reverse primer: 5′ CCTGAAGCATTTGCGGTGCACGATG 3′. The threshold cycles (Ct) of TRAIL and β-actin genes were measured, and the difference between their ∆Ct was calculated. Relative expression was then calculated using the 2-∆∆Ct method, and the results was compared to that of the control group.
9
Quantitative real-time PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tumor tissues or cell lines was extracted with TRIzol (Invitrogen). Total RNA was reverse transcribed using 4×Reverse Transcription Master Mix (EZBioscience, USA) according to the manufacturer's instructions. Quantitative real‐time PCR was performed using 2×SYBR Green qPCR Master Mix (EZBioscience, USA) and a Roche LightCycler 480 Instrument. The forward and reverse primers used in this study are listed in Table S4 (Supporting Information).
10
Genetic Factors in Inflammatory Biomarkers
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!