Miseq pe300

Fungal community composition was analysed by a culture-independent approach using next-generation sequencing (NGS). The grape samples from every vineyard were collected in duplicate, immediately transported to the laboratory and processed. Total genomic DNA was extracted using the Stool DNA Isolation Kit (Norgen, Biotek Corp., Thorold, ON, Canada) according to the manufacturer’s instructions. The concentration and purity of the extracted nucleic acids were visualised and quantified, after agarose gel electrophoresis, by Nanodrop (NanoDropTM 2000/2000c; Thermo Fisher Scientific, Italy). DNA quantity was standardized to a concentration of 10 ng/μl. The ITS2 (internal transcribed spacer) region of the rRNA was amplified using primers 2024F and 2409R. Amplicons were sequenced using the Illumina MiSeq PE300 platform (Illumina, San Diego, CA, USA) at Biodiversa s.r.l. (Rovereto, Italy). Adapter sequences were removed using Cutadapt (Martin, 2011 (link)). Read quality was assessed using DADA2 (Callahan et al., 2016 (link)). The taxonomic references were assigned using trained OTUs at 99% from UNITE database version 8.2 (https://unite.ut.ee) within Qiime2 tools version 2020.2 (https://qiime2.org) (Bolyen et al., 2019 (link)). The raw data have been deposited in Mendeley Data with the accession number DOI: 10.17632/tp2rrdz8wp.2.

Universal primers 338F (5’- ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’- GGACTACHVGGGTWTCTAAT-3’) were employed to amplify gDNA. Purified amplicons were pooled in equimolar and paired-end sequenced on an Illumina MiSeq PE300 platform (Illumina, San Diego, USA) according to the standard protocols. The raw 16S rRNA gene sequencing reads were demultiplexed, quality-filtered by FASTp software (https://github.com/OpenGene/fastp, version 0.20.0) and merged by FLASH software (http://www.cbcb.umd.edu/software/flash, version 1.2.7). Operational taxonomic units (OTUs) with 97% similarity cutoff were clustered using UPARSE (http://drive5.com/uparse/, version 7.1), and chimeric sequences were identified and removed. The taxonomy of each OTU representative sequence was analyzed by RDP Classifier (http://rdp.cme.msu.edu/, version 2.2) against the 16S rRNA database using confidence threshold of 70%.

The extraction of total DNA and construction of 16S rRNA V3-V4 hypervariable regions libraries were done using a FastDNA® Spin Kit for Soil (MP Biomedicals, USA) and NEXTflex^TM Rapid DNA-Seq Kit (Bioo Scientific, USA), respectively. All raw reads sequenced by the Illumina MiSeq PE300 platform were quality-controlled, merged, and trimmed by fastp version 0.20.0 (Chen et al., 2018 (link)). Operational taxonomic units (OTUs) were clustered with a 97% similarity threshold in Uparse version 7.0.1090 (Edgar, 2013 (link)). The sequence taxonomy was identified by the RDP Classifier Bayesian algorithm against the Silva 16S rRNA database (version 1.3.8), with a default confidence threshold of 0.7. All raw reads were deposited in the NCBI Sequence Read Archive (SRA) database (BioProject ID: PRJNA1018001).
Alpha diversity indices (Sobs index, Simpson index, Shannoneven index, and Pd index) of the microbiome were estimated using Mothur (v1.30.2). Significant differences in alpha diversity indices were tested by Welch’s t-test at the OTU level. Beta diversity analysis results were visualized by the principal coordinates analysis (PCoA) clustered at the OTU level based on Bray-Curtis metrics. Species differences between adult and juvenile groups were analyzed by the Wilcoxon rank-sum test.

The sequencing of the V3–V4 hypervariable region of the 16S rRNA gene was performed for bacterial identification (Caporaso et al., 2011 (link); Lundberg et al., 2013 (link)). Thirty-five cycles of polymerase chain reaction (PCR) amplification of the target marker genes were performed. Error-correcting 12-bp barcoded primers specific to each sample were used to permit multiplexing of samples. Polymerase chain reaction products from all samples were quantified using the PicoGreen dsDNA assay and pooled together in equimolar concentrations. Each library was submitted to Mega Biotech on the Illumina MiSeq PE300 platform.

Using the E.Z.N.A.® Soil DNA Kit (Omega Bio‐tek), total microbial genomic DNA was extracted from feces. DNA quality and concentration were determined by 1.0% agarose gel electrophoresis and NanoDrop ND‐2000 spectrophotometer (Thermo Scientific Inc.). DNA was stored at −80°C for subsequent analysis. The V3‐V4 hypervariable region of the bacterial 16S rRNA gene was amplified by ABI GeneAmp® 9700 polymerase chain reaction (PCR) thermocycler (ABI) with primer pairs 338F (5'‐ACTCCTACGGGAGGCAGCAG‐3') and 806R (5’‐GGACTACHVGGGTWTCTAAT‐3').³⁷ PCR reaction mix included 10 ng template DNA, 0.8 μl each primer (5 μM), 2 μl 2.5 mM dNTP, 0.2 μl BSA, 4 μl 5 × Fast Pfu buffer, 0.4 μl Fast Pfu polymerase, and ddH₂O (20 μl final volume). All samples were amplified in triplicate. PCR amplification conditions were as follows: initial denaturation at 95°C for 3 min, amplification for 27 cycles (each cycle consists of denaturation at 95°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 45 s), single extension at 72°C for 10 min, and end at 4°C. PCR products were extracted from 2% agarose gel, then purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences) and quantified using Quantus™ Fluorometer (Promega). 16S rRNA gene sequencing data were processed using the Illumina MiSeq PE300/NovaSeq PE250 platform, details are provided in the Supplementary Materials.

An E.Z.N.A.^® Soil DNA Kit (Omega Bio-tek, Inc., GA, USA) was used to extract microbial DNA from cecal samples. According to our previous study, primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) were used to amplify the bacterial 16S rRNA genes (V3–V4 hypervariable regions) (18 (link)). Sequencing was performed by Majorbio Technology Co. Ltd. (Shanghai, China) using the Illumina MiSeq PE300 platform (Illumina).
The raw 16S rRNA sequence data were demultiplexed, quality-filtered, and merged using fastp software (version 0.20.0) (33 (link)) and FLASH software (version 1.2.7) (34 (link)). All sequences were clustered into different operational taxonomic units (OTUs) at 97% similarity using UPARSE software (version 7.1) (35 (link)) by removing the chimeric sequences. The taxonomy of the 16S rRNA amplicon sequences was analyzed using the RDP Classifier software (version 2.2) (36 (link)) against the Silva v138 database with a confidence threshold of 0.7.
Alpha diversity and coverage indices were calculated. Principal coordinates analysis (PCoA) and the Adonis test were used to evaluate beta diversity among the groups. Linear discriminant analysis effect size (LEfSe) analysis was used to identify differentially abundant bacteria among the three groups with a cutoff threshold of 3.0. KEGG metabolic pathways were predicted using the PICRUSt software package.