Total RNA was extracted from the clinical specimens using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Subsequently, the RNAs were reversed transcribed into cDNA using a reverse transcription reagent kit (Takara Biotechnology Co., Ltd., Dalian China). Subsequently, cDNA was amplified using an SYBR Green mix kit and the ABI 7900 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. PCR was performed with the following thermocycling conditions: Initial denaturation at 94°C for 4 min, 40 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 25 sec, using the ABI 7900 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific Inc.). The primer sequences are shown in Table II . Relative levels of miR-539 and mRNA expression levels of HMGA2 were normalized to that of small nuclear RNA U6 (for miRNAs) or GAPDH (for mRNAs) respectively. The relative expression of miRNA or mRNA was calculated using the 2−ΔΔCt method (15 (link)).
Abi 7900 real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China, Germany
The ABI 7900 real-time PCR system is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It features a 96-well thermal cycler, an optical detection system, and software for data acquisition and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (67 mentions)
Primescript rt reagent kit, by Takara Bio (24 mentions)
Miscript sybr green pcr kit, by Qiagen (11 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (9 mentions)
Sybr green mix kit, by Thermo Fisher Scientific (8 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (7 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Taqman microrna assay kit, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq 2, by Takara Bio (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Sds 2, by Thermo Fisher Scientific (6 mentions)
Taqman assay, by Thermo Fisher Scientific (5 mentions)
Sds version 2, by Thermo Fisher Scientific (5 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (5 mentions)
Taqman mirna assay, by Thermo Fisher Scientific (5 mentions)
Sybr premix ex taq, by Takara Bio (5 mentions)
Sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Takara Bio (5 mentions)
210 protocols using abi 7900 real time pcr system
1
Quantitative Analysis of miRNA and mRNA Expression
2
Quantitative Analysis of CircRNA and mRNA Decay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells transfected with indicated siRNAs were directly harvested or treated with 1 μg/ml Actinomycin D (mRNA decay, Sigma-Aldrich) and harvested at indicated time points. Hsa_circRNA_0006401 and mRNA level was detected by qRT-PCR utilizing TB GreenTM Premix DimerEraserTM (Perfect Real Time) on the ABI 7900 Real-Time PCR System (Thermo Fisher Scientific, USA). The reaction conditions were set according to the manufacturer’s protocol (Takara, Beijing). The human GAPDH reference gene was used as an internal control. For mRNA decay assay, 28S RNA was used as an internal control. All assays were conducted in triplicate. The PCR products were sent to GENESEED (Guangzhou, China) for sequencing to ensure the accuracy of circRNA detection. Primer information is as follows:
hsa_circ_0006401 Forward, 5ʹ-TGGCTCTCACTGAAACAGAAATG-3ʹ;
Reverse, 5ʹ-GTCGTCAC TGGGTTGGATGTAG-3ʹ
TGFβ1 Forward, 5ʹ-CGGCTGC TGCTGAAAGCCGACCA-3ʹ;
Reverse, 5ʹ-GGTCGGGGCCAAAAGCGTGT-3ʹ
COL6A3 Forward, 5ʹ-ATGAGGAAACATCGGCACTTG-3ʹ;
Reverse, 5ʹ-GGGCATGAGTTGTAGGAAAGC-3ʹ
GAPDH Forward, 5ʹ-AGTCAGCATT TCACAAGACCTC-3ʹ;
Reverse, 5ʹ-CAGGCGAAGATGTTCTGGC-3ʹ;
28S RNA Forward, 5ʹ-CCCAGTGCTCTGAATGTCAA-3ʹ;
Reverse, 5ʹ-AGTGGGAATCTCGTTCATCC-3ʹ.
hsa_circ_0006401 Forward, 5ʹ-TGGCTCTCACTGAAACAGAAATG-3ʹ;
Reverse, 5ʹ-GTCGTCAC TGGGTTGGATGTAG-3ʹ
TGFβ1 Forward, 5ʹ-CGGCTGC TGCTGAAAGCCGACCA-3ʹ;
Reverse, 5ʹ-GGTCGGGGCCAAAAGCGTGT-3ʹ
COL6A3 Forward, 5ʹ-ATGAGGAAACATCGGCACTTG-3ʹ;
Reverse, 5ʹ-GGGCATGAGTTGTAGGAAAGC-3ʹ
GAPDH Forward, 5ʹ-AGTCAGCATT TCACAAGACCTC-3ʹ;
Reverse, 5ʹ-CAGGCGAAGATGTTCTGGC-3ʹ;
28S RNA Forward, 5ʹ-CCCAGTGCTCTGAATGTCAA-3ʹ;
Reverse, 5ʹ-AGTGGGAATCTCGTTCATCC-3ʹ.
3
Quantification of miR-612 and NOB1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cultured cells using TRIzol reagent (Invitrogen), followed by purification using an RNeasy Maxi kit (Qiagen). MiR‐612 expression was examined using the TaqMan microRNA Assay Kit (Thermo Fisher Scientific, Inc) in an ABI 7900 real‐time PCR system (Thermo Fisher Scientific, Inc) following the prescribed protocols. NOB1 mRNA expression was detected as described in our previous study.18 The endogenous control for miR‐612 was U6 while that for NOB1 was GAPDH. Relative expression levels were calculated by the 2−ΔΔCt method using ABI software.19
4
Quantifying Gene Expression in BpV-Treated HT22 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HT22 cells were cultured to 70% confluence in culture dishes with 5% CO2 and 95% air at 37°C. BpV (0.3 or 3 μM) was added for 12 or 24 hours. Total RNA was extracted from HT22 cells with or without BpV treatment using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentration and purity of RNA were determined spectrophotometrically by reading the absorbance at 260 and 280 nm. Aliquots (3 µg) of total RNA were reverse transcribed into cDNA using a commercial kit (Invitrogen). Real time-PCR was conducted in triplicate on an ABI 7900 real-time PCR system using PowerUP SYBR green master mix (Thermo Fisher Scientific, San Jose, CA, USA), a Quant Studio 7 Flex instrument, and fast gene-expression method with the following cycling conditions: 95°C for 2 minutes; 40 cycles of 95°C for 30 seconds, 59°C for 30 seconds, and 72°C for 30 seconds; followed by 72°C for 2 minutes. Reactions were carried out in triplicate and β-actin gene expression was used as an internal control to normalize variability in expression levels. The results were analyzed by the 2-ΔΔCT value method, as previously described (Zhang et al., 2014, 2016). Primers used in this study are shown in Table 1
5
Profiling Serum miR-195 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from serum and cell lines by using Trizol reagent (Thermo Fisher Scientific) according to the manufacturer’s instruction. Reverse transcription was performed using miScript (SYBR™) Green PCR kit (Qiagen NV, Venlo, the Netherlands) according to the manufacturer’s protocol. Total RNA concentration was assessed by measuring absorbance at 260 and 280 nm (A 260/280 ratio) and checked by gel electrophoresis individually. In general, 800 ng of RNA from 1 mL of serum was used for further use. The relative expression levels of miR-195 were detected by qRT-PCR, which was performed with the SYBR™ Green PCR master mix (Thermo Fisher Scientific) on an ABI 7900 real-time PCR system (Thermo Fisher Scientific). The relative quantification of miR-195 expression was calculated with the 2−ΔΔCt methods normalized to miR-16.
6
Quantifying Gene Expression using qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of RNA was reverse transcribed to cDNA using either Applied Biosystem’s High Capacity RNA-to-cDNA kit or AMV Reverse Transcriptase System (Promega). qPCR was used to quantify the level of mRNA expression of the genes of interest. This was performed using a C1000 Touch Thermal Cycler machine, CFX Manage TM Software v3.1 (Bio-Rad) or ABI 7900 Real-time PCR system, 7900 SDS v2.4.1 (Thermo Fisher Scientific) and the TaqMan Fast Advanced Gene Expression Master Mix (Applied Biosystems, 4369514). The genes of interest were identified using commercially available probes from Thermo Fisher Scientific, with Assay ID listed in Supplementary Table 16 . Results were analyzed using the 2−ΔΔCT method, using the housekeeping gene 18S rRNA or β-actin for normalization, unless otherwise specified.
7
Quantitative Real-Time RT-PCR Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We prepared complimentary DNA (cDNA) from total mRNA using the High-Capacity cDNA Archive Kit (Life Technologies, Foster City, CA). Quantitative real-time RT-PCR (qRT-PCR) was performed for selected genes using Taqman® assays (Life Technologies) to confirm microarray experiment findings for the selected genes. Assays used were: IL1R1 (assay ID: Rh00991008_m1), LY96 (assay ID: Rh01026731_m1, MARCKSL1 (assay ID: Hs00702769_s1) and FAIM3 (assay ID: Rh02857660_m1). 30 ng of cDNA was used as input in duplicate reactions. Quantitative real time PCR reactions were performed with the ABI 7900 Real Time PCR System using Universal PCR Master Mix (Thermofisher), with initial activation at 50°C for 120 seconds and 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Relative fold-induction was calculated by the -ΔΔCT method [43 (link)], using SDS version 2.4 (Thermofisher). Data were normalized to GAPDH (assay ID: Rh02621745_g1) gene expression levels, which were found to be stably expressed across all samples.
8
Quantifying BMSC Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from BMSCs with Cell/Bacteria Kit (Tiangen Biotech Co., Ltd., Beijing, China) after 24 h of culture in complete medium and 14 days of culture in osteogenic medium respectively. qRT-PCR primers were shown in Supplementary Table S2 . GAPDH was used as a reference, and quantitative real-time PCR was performed on an ABI 7900 Real-Time PCR System (Thermo Fisher Scientific) with TB Grenn Premix Ex Taq II (RR820A; Takara Bio Inc., Japan) according to the manufacturer’s instructions. Relative expression levels were calculated by the 2−ΔΔCt method, and each analysis included three to five replicates.
9
Quantitative mESC Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mESCs using TRIzol (Invitrogen) according to the manufacturer's instruction. Reverse transcription (RT) was performed using ProtoScript First Strand cDNA Synthesis kit (New England Biolabs) to generate cDNA. RT-qPCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad) on the ABI 7900 Real-Time PCR system (Thermo Fisher Scientific) using specific primers (Supplementary Table S1 ).
10
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was prepared from total globin-cleared RNA using the High-Capacity cDNA Archive kit (Thermofisher). Quantitative real-time PCR (qRT-PCR) was performed for five genes (Ube2c, Fzr1, Ccna2, Cdc25b, and Nusap1) using Taqman assays (Thermofisher). Fzr1 (Mm00517239_m1), Ccna2 (Mm00438063_m1), Cdc25b (Mm00499136_m1), Nusap1 (Mm00505601_m1) were pre-designed validated assays. Mouse Ube2c primers were designed using the PrimerQuest Tool (Integrated DNA Technologies), and the sequences were as follows: forward primer, CTGCTAGGAGAACCCAACATC; reverse primer: GCTGGAGACCTGCTTTGAATA; and probe: CTTTGAACACACACGCTGCGGAAC. A β-actin assay (Mm00607939_s1) was also performed alongside as control. The gene expression validation experiments were conducted with 20 ng cDNA using Universal PCR Master Mix (Thermofisher) in an ABI 7900 Real Time PCR system. After an initial activation at 50 °C for 2 min and 95 °C for 10 min, the PCR reaction was performed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Relative fold-induction was calculated by the 2-ΔΔCT method [21 (link)], using SDS version 2.3 (Thermofisher). Data were normalized to β-actin gene expression levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!