T4 ligase

A 50-μg aliquot of GS115 genomic DNA, isolated by lysis with glass beads, was digested with either Sau3AI, TaqI or BsuRI for 10 min in a total volume of 200 μl. The digested DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (PCI 25:24:1), the aqueous phase was re-extracted with CI (24:1) and precipitated. The DNA was resuspended in 500 μl ligase buffer and self-ligated for 1 h at 16 °C with T4 ligase (Takara). The ligated DNA was extracted once with PCI followed by a CI extraction and precipitation. The circularised DNA was linearized by digestion with KpnI in a total volume of 50 μl at 37 °C overnight. The digested DNA was extracted with PCI, precipitated and resuspended in 50 μl of TE buffer. A 2-μl aliquot of the DNA sample was used in PCR reactions with primers Cys_for (gctcaggcttgcaaaggctgtccagc) and GATA6_rev (acacctaccgtcacctttacaagttcc). PCR conditions were as follows: initial denaturation at 95 °C for 5 min followed by 25 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min, followed by a final extension at 72 °C for 7 min. The PCR products obtained, about 1000 bp for Sau3AI, 450 bp for TaqI and 1100 bp for BsuRI were cloned in EcoRV-digested pBluescript II KS. Automated DNA sequencing was performed at Ylichron (ENEA, Italy).

Strains and plasmids used for construction of gene deletion mutants are presented in Table 1. Gene deletion was performed by homologous recombination strategy, using the temperature-sensitive pMAD shuttle vector (Arnaud et al., 2004 (link)). An insert containing homologous arms up- and down-stream of the target gene was obtained by the splicing by overlap extension (SOE) PCR using the primers in Table S2. The insert and pMAD were digested using appropriate restriction enzymes (Takara) and ligated into pMAD by using T4 ligase (Takara). The recombinant plasmid was transformed into chemically competent E. coli DH5α cells (Biomed, Beijing, China). After confirmation by sequencing, the recombinant vector was electroporated into the competent L. monocytogenes cells (1.8 kV, 25 μF, 200 Ω). Transformants were selected on BHI agar plates containing erythromycin (5 μg/ml). Single-crossover mutant was selected at 39°C with erythromycin to promote chromosomal integration and double-crossover mutant at 39°C without antibiotic to enable plasmid curing. The deletions were confirmed by PCR and sequencing.

As described elsewhere [60 (link)], cDNA was prepared from the total mRNA extracted from the discarded human myocardium, which was derived from a patient undergoing radical surgery for tetralogy of Fallot. The whole open reading frame of wild-type human BMP10 (accession no. NM_014482.3) was yielded by polymerase chain reaction (PCR) with the Phusion^® DNA polymerase (NEB) and a specific pair of primers of 5′-GTGGCTAGCTAAACCTTCCTGGCTTGGCC-3′ (forward) and 5′-CACTCTAGAGCCTCTATTACTGTACACCC-3′ (reverse). The produced full-length BMP10 cDNA and the pcDNA3.1 plasmid were doubly digested by NheI and XbaI (NEB), purified, and ligated by T₄ ligase (TaKaRa) to construct the wild-type BMP10-pcDNA3.1 plasmid. The Gln56*-mutant BMP10-pcDNA3.1 plasmid was produced via site-directed mutagenesis employing the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) with the complimentary primer pairs of 5′-TTTAACACACTGCTCTAGAGCATGAAGGATG-3′ (forward) and 5′-CATCCTTCATGCTCTAGAGCAGTGTGTTAAA-3′ (backward) and was then confirmed by direct sequencing analysis. The human NKX2.5 promoter-driven firefly luciferase reporter vector (NKX2.5-luc) and the human TBX20 promoter-driven firefly luciferase reporter plasmid (TBX20-luc) were constructed as described previously [65 (link)]. All the final recombinant constructs were verified by Sanger sequencing analysis.

Cellulase Cellic CTec2 was purchased from Novozymes (China), Beijing, China. The filter paper activity was determined to be 203.2 FPU/mL according to NREL protocol LAP-006 [33 ]; cellobiase activity was determined to be 4900 CBU/mL according to the method reported previously [34 (link)]. Total protein concentration was 87.3 mg/mL based on the Bradford method [35 (link)]. DNA polymerase and T4 ligase were purchased from Takara, Otsu, Japan. Restriction endonucleases were purchased from Thermo Scientific, Wilmington, DE, USA. Seamless cloning kit HB-infusion^TM was purchased from Hanheng Biotech Co., Nanjing, China. Penicillin G with the titer of 1650 U/mg was purchased from New Probe Biochem Co., Beijing, China. Other general chemicals used in this study were of analytical grade and purchased from local suppliers.

The vector pCDH-CMV-MCS-EF1-copGFP was used as a backbone plasmid to reconstruct the lentiviral vector containing IL-33. Rat IL-33 mRNA was amplified from mRNA using a reverse transcript kit (Takara, RR037A) and PrimerSTAR HS DNA polymerase (Takara, R010A). The primers used for amplifying the IL-33 fragment were as follows: sense, 5′ TTAAGGATCCGCCACCATGAGACCTAGAATGAAGTATTCGAAC 3′; and antisense, 5′ TTTTTCTAGATTACATCTTAGAGAGCTTAAACATGATAT 3′. The IL-33 fragments were cloned into the linearized vector (cut by XbaI and BamHI) and ligated with T4 ligase (Takara). The fusion product (pCDH-IL33) was subsequently transformed into competent Stbl3. Clones were selected by ampicillin. The reconstructed plasmids were verified by Sanger sequencing.
For lentiviral production, control vector or pCDH-IL33 with psPAX and pMD2.G were co-transfected into HEK293NT cells. The culture medium was collected at 24 h and 48 h after transfection and then filtered through a 0.45-μm filter before incubation overnight with polyethylene glycol 8000 (PEG 8000) and centrifugation (4000×g, 20 min at 4 °C; Thermo). Lentivirus particles were stored at − 80 °C after titration using a titer kit. The ratio of lentivirus-infected MSCs was observed under an inverted fluorescence microscope (Olympus, Tokyo, Japan).

PcTrim was amplified using PcTrim-Ex-F/R. The PCR procedure was as follows: 95 °C for 5 min, 40 cycles at 95 °C for 30 s, 58 °C for 35 s, 72 °C for 50 s, and one cycle at 72 °C for 10 min. Both the DNA fragment (PcTrim) and the vector (pET-32a) were digested with the corresponding restriction enzymes at 37 °C for 10 min and placed into a water bath for 2 h at 22 °C with T4 ligase (Takara, China). Recombinant PcTrim was expressed in Escherichia coli BL21 (DE3) cells and purified with His resin following the manufacturer’s instructions. A specific polyclonal antibody against PcTrim was obtained by immunizing rabbits with purified PcTrim.