Log In Sign up
The largest database of trusted experimental protocols

Tsa plus cyanine 5 system

Manufactured by PerkinElmer
Visit Supplier
Sourced in United States

The TSA Plus Cyanine 5 System is a laboratory instrument designed for nucleic acid detection and quantification. It utilizes a cyanine 5 dye for fluorescent labeling and detection of target molecules.

Automatically generated - may contain errors

Lab products found in correlation

Tsa plus cyanine 3 system, by PerkinElmer (3 mentions) Cryostat, by Leica (2 mentions) Rnascope probe, by Advanced Cell Diagnostics (2 mentions) Ab144p, by Fujifilm (2 mentions) Eclipse 80i, by Nikon (1 mentions) Desmin, by Thermo Fisher Scientific (1 mentions) Vectashield with dapi, by Vector Laboratories (1 mentions) Bmk 2202, by Vector Laboratories (1 mentions) Myod1, by Cell Marque (1 mentions) Myogenin, by Agilent Technologies (1 mentions) Tsa plus fluorescien system, by PerkinElmer (1 mentions) Alexa fluor 488 labeled secondary antibody, by Thermo Fisher Scientific (1 mentions) Hydrogen peroxide solution, by Merck Group (1 mentions) Protease 3, by Advanced Cell Diagnostics (1 mentions) Multiplex fluorescent v2 assay, by Advanced Cell Diagnostics (1 mentions) Tsa plus fluorescein system, by PerkinElmer (1 mentions) Decloaking chamber, by Biocare Medical (1 mentions) Ar6 buffer, by PerkinElmer (1 mentions) Opal 520 reagent pack, by PerkinElmer (1 mentions) Spectral dapi, by PerkinElmer (1 mentions)

Spelling variants of this product

TSA Plus Cyanine 5 (18 citations) TSA Plus System (14 citations) TSA system (13 citations) Cyanine 5 (11 citations) TSA Cyanine 5 System (4 citations) TSA Plus Cyanine 3 / Cyanine 5 system (2 citations)

11 protocols using tsa plus cyanine 5 system

1

Spinal Cord RNA Expression and Immunohistochemistry

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transcardially perfused spinal cords were collected, post-fixed in 4% PFA for 24 hours at 4°C, and cryopreserved overnight in sequential 10%, 20% and 30% sucrose solutions. Spinal cord L1-L3 segments were then sectioned at 20 μm thickness using a cryostat (Leica) and mounted on superfrost slides. Fluorescent in situ hybridization for C1qa was performed using RNAscope probe from Advanced Cell Diagnostics (ACD, #441221-C3) and the RNAscope Multiplex Fluorescent Reagent Kit V2 (ACD, #323110) following the manufacturer’s recommendations. TSA Plus Cyanine 5 System (PerkinElmer, #NEL745E001KT) was used for developing HRP-C1 signal. The sample slides were briefly washed with PBS after the last wash in the RNAscope protocol, subsequently blocked in 10% NDS, and stained overnight at room temperature in a wet chamber with antibodies against ChAT (1:100; Millipore, AB144P) and against Iba1 (1:500; Wako 019–19741). The following day, sections were washed in PBS-T and secondary antibody incubation was performed for 2 hours. Sections were subsequently washed in PBS, mounted on glass slides using ProLong Gold Antifade Mountant (#P36931) and coverslipped.
Vukojicic A., Delestrée N., Fletcher E.V., Pagiazitis J.G., Sankaranarayanan S., Yednock T.A., Barres B.A, & Mentis G.Z. (2019). The Classical Complement Pathway Mediates Microglia-Dependent Remodeling of Spinal Motor Circuits during Development and in SMA. Cell reports, 29(10), 3087-3100.e7.
+ Open protocol
+ Expand
2

Immunocytochemistry of Myogenic Markers

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ICC was performed on cells grown on coverslips 5 days after transfection. Cells were fixed in 4% paraformaldehyde, permeabilized in 0.1% Triton X-100 and blocked in 15% normal goat serum (10000C; Invitrogen). Primary and secondary antibodies (Supplementary Table S3) were serially incubated for 1 h at room temperature. Coverslips were mounted with VectaShield with DAPI (H-1500; Vector Laboratories, Burlingame, CA, USA). Images captured with a Nikon Eclipse 80i (Nikon, Tokyo, Japan) at a magnification of × 40. Immunohistochemistry performed as previously described using antibodies for Desmin (Thermo Fisher Scientific), MyoD1 (Cell Marque, Rocklin, CA, USA) and Myogenin (Dako, Carpinteria, CA, USA).32 (link) For Pax7 IHC in tumors, PAX7 was detected using the Mouse on Mouse (M.O.M.) kit following the manufacturer's instructions (BMK-2202; Vector Laboratories); however, the signal was detected with the TSA-Plus Cyanine 5 System (NEL745001KT; Perkin Elmer, Waltham, MA, USA) following the manufacturer's instructions.
Hanna J.A., Garcia M.R., Go J.C., Finkelstein D., Kodali K., Pagala V., Wang X., Peng J, & Hatley M.E. (2016). PAX7 is a required target for microRNA-206-induced differentiation of fusion-negative rhabdomyosarcoma. Cell Death & Disease, 7(6), e2256-.
+ Open protocol
+ Expand
3

Identifying Olfactory Receptor Genes in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from the heads of 3 dpf wild type zebrafish and used to perform RT-PCR with degenerate or specific OR primers that amplified ORs belonging to the OR111, OR106, OR128, OR133, OR125, or OR103 subfamilies. PCR products (~ 650 bp long) were cloned into the pCR II-TOPO vector and recovered OR sequences were identified by sequencing. Digoxigenin and fluorescein labeled antisense RNA probes were generated from OR-containing plasmids by in vitro transcription (T7 and Sp6 from Promega Corp.). Embryos were incubated in 0.2% DEPC-Collagenase 25 °C for 2 h, hybridized with OR probes in DEPC-HYB+ and in situ signals were amplified using a Cyanine 3-coupled tyramide signal amplification system (TSA Plus Cyanine 3 System, Perkin Elmer, Product number: NEL744001KT), a Cyanine 5-coupled tyramide system (TSA Plus Cyanine 5 System, Perkin Elmer, Product number NEL745001KT) or a Fluorescein-coupled tyramide system (TSA Plus Fluorescien System, Perkin Elmer, Product number NEL741001KT) as described in Chalasani et al. [33 (link)].
Shao X., Lakhina V., Dang P., Cheng R.P., Marcaccio C.L, & Raper J.A. (2017). Olfactory sensory axons target specific protoglomeruli in the olfactory bulb of zebrafish. Neural Development, 12, 18.
+ Open protocol
+ Expand
4

Multi-Marker Immunohistochemistry of SARS-CoV-2

Check if the same lab product or an alternative is used in the 5 most similar protocols
A monoclonal rabbit antibody to GRP78 (BiP (C50B12) Rabbit mAb; Cell Signaling, Danvers, MA; Cat#3177; 1:200) and Envision Plus polymer (Agilent/DAKO) were used with magenta chromogen for visualization. Immunohistochemistry for SARS-CoV-2 nucleocapsid protein was performed using an affinity-purified polyclonal rabbit antibody (affinity-purified rabbit IgG; ProSci, Poway, CA; Cat# 9099; 0.04 µg/ml). Multiplex immunofluorescence staining of GRP78 was visualized using the TSA Plus Cyanine 3 System, Perkin Elmer, Waltham, MA: Cat# NEL744B001KT. SARS-CoV-2 nucleocapsid was visualized using the TSA Plus Cyanine 5 System (Perkin Elmer Cat# NEL745001KT). Macrophages/monocytes were identified using CD68 (CD68 Monoclonal Antibody KP1, Thermo Fisher Scientific, Grand Island, NY; Cat# 14-0688-82) and visualized using the TSA Plus Cyanine 7 System (Perkin Elmer, Cat# CUSM03644000EA) following the addition of peroxidase blocking reagent (hydrogen peroxide solution, Sigma-Aldrich, St. Louis, MO; Cat# H1009). Antibody stripping was accomplished using the Omnis (Dako/Agilent) low (CD68 and SARS-CoV-2 nucleocapsid) or high (GRP78) pH antigen retrieval protocol. Pneumocytes were identified using anti-pan-cytokeratin antibody (mouse monoclonal AE1/AE3 blend, Cat# M3515, Agilent) followed by Alexa-Fluor-488-labeled secondary antibody (Cat# A11029, Thermo Fisher Scientific).
Puzyrenko A., Jacobs E.R., Sun Y., Felix J.C., Sheinin Y., Ge L., Lai S., Dai Q., Gantner B.N., Nanchal R., North P.E., Simpson P.M., Rui H, & Benjamin I.J. (2021). Pneumocytes are distinguished by highly elevated expression of the ER stress biomarker GRP78, a co-receptor for SARS-CoV-2, in COVID-19 autopsies. Cell Stress & Chaperones, 26(5), 859-868.
+ Open protocol
+ Expand
5

Spinal Cord RNA Expression and Immunohistochemistry

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transcardially perfused spinal cords were collected, post-fixed in 4% PFA for 24 hours at 4°C, and cryopreserved overnight in sequential 10%, 20% and 30% sucrose solutions. Spinal cord L1-L3 segments were then sectioned at 20 μm thickness using a cryostat (Leica) and mounted on superfrost slides. Fluorescent in situ hybridization for C1qa was performed using RNAscope probe from Advanced Cell Diagnostics (ACD, #441221-C3) and the RNAscope Multiplex Fluorescent Reagent Kit V2 (ACD, #323110) following the manufacturer’s recommendations. TSA Plus Cyanine 5 System (PerkinElmer, #NEL745E001KT) was used for developing HRP-C1 signal. The sample slides were briefly washed with PBS after the last wash in the RNAscope protocol, subsequently blocked in 10% NDS, and stained overnight at room temperature in a wet chamber with antibodies against ChAT (1:100; Millipore, AB144P) and against Iba1 (1:500; Wako 019–19741). The following day, sections were washed in PBS-T and secondary antibody incubation was performed for 2 hours. Sections were subsequently washed in PBS, mounted on glass slides using ProLong Gold Antifade Mountant (#P36931) and coverslipped.
Vukojicic A., Delestrée N., Fletcher E.V., Pagiazitis J.G., Sankaranarayanan S., Yednock T.A., Barres B.A, & Mentis G.Z. (2019). The Classical Complement Pathway Mediates Microglia-Dependent Remodeling of Spinal Motor Circuits during Development and in SMA. Cell reports, 29(10), 3087-3100.e7.
+ Open protocol
+ Expand
6

Cardiac Tissue Cryosectioning and RNA in situ Hybridization

Check if the same lab product or an alternative is used in the 5 most similar protocols
After fixation, the cardiac tissues were embedded in O.C.T. compound, and 10-μm sections were prepared using a cryostat. RNAscope in situ hybridization was performed according to the manufacturer’s protocol using the Multiplex Fluorescent V2 Assay (Advanced Cell Diagnostics, Hayward, CA, catalog no. 323110). Modifications to the protocol were as follows: Target retrieval was performed for 5 min, and pretreatment was 15 min using Protease III (Advanced Cell Diagnostics, Hayward, CA, catalog no. 322337). For detection, the TSA Plus Cyanine 3 System (Perkin Elmer, Waltham, MA, catalog no. NEL744001KT) and the TSA Plus Cyanine 5 System (Perkin Elmer, Waltham, MA, catalog no. NEL745001KT) were used. Last, slides were covered using Fluor-Gel II with 4′,6-diamidino-2-phenylindole (Electron Microscopy Sciences, Hatfield, PA, no. 17985-50).
Dong Y., Yang Y., Wang H., Feng D., Nist E., Yapundich N., Spurlock B., Craft M., Qian L, & Liu J. (2024). Single-cell chromatin profiling reveals genetic programs activating proregenerative states in nonmyocyte cells. Science Advances, 10(8), eadk4694.
+ Open protocol
+ Expand
7

Whole-Mount In Situ Hybridization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
In situ probes for unc5b, ntn1a, and ntn1b were generated from plasmids gifted from the Chein laboratory (Fricke and Chien, 2005 (link); Suli et al., 2006 (link)). Antisense digoxigenin (DIG) RNA probes were generated using the DIG RNA labeling kit (Sigma-Alderich, 11175025910) followed by LiCL purification.
Embryos from 36 hpf to 72 hpf were fixed in 4% PFA in DEPC-PBS overnight (16hr) at 4°C and then serially dehydrated in methanol and stored at −20°C until required. Embryos were rehydrated in DEPC-PBS 0.02% Tween-20 before being permeabilized with proteinase K for 36–60 hpf embryos and 0.2% collagenase for 72 hpf embryos. In situ hybridization experiments were performed as previously described (Chalasani et al., 2007 (link)). In situs were developed for 10 min at RT using a cyanine 5-coupled tyramide system (TSA Plus cyanine 5 System, PerkinElmer, product number NEL745001KT). After in situ signal amplification, antibody staining, nuclear staining, mounting and imaging were performed as described above.
Dang P., Barnes D.T., Cheng R.P., Xu A., Moon Y.J., Kodukula S.S, & Raper J.A. (2022). Netrins and netrin receptors are essential for normal targeting of sensory axons in the zebrafish olfactory bulb. Neuroscience, 508, 19-29.
+ Open protocol
+ Expand
8

Whole-Mount In Situ Hybridization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
In situ probes for unc5b, ntn1a, and ntn1b were generated from plasmids gifted from the Chein laboratory (Fricke and Chien, 2005 (link); Suli et al., 2006 (link)). Antisense digoxigenin (DIG) RNA probes were generated using the DIG RNA labeling kit (Sigma-Alderich, 11175025910) followed by LiCL purification.
Embryos from 36 hpf to 72 hpf were fixed in 4% PFA in DEPC-PBS overnight (16hr) at 4°C and then serially dehydrated in methanol and stored at −20°C until required. Embryos were rehydrated in DEPC-PBS 0.02% Tween-20 before being permeabilized with proteinase K for 36–60 hpf embryos and 0.2% collagenase for 72 hpf embryos. In situ hybridization experiments were performed as previously described (Chalasani et al., 2007 (link)). In situs were developed for 10 min at RT using a cyanine 5-coupled tyramide system (TSA Plus cyanine 5 System, PerkinElmer, product number NEL745001KT). After in situ signal amplification, antibody staining, nuclear staining, mounting and imaging were performed as described above.
Dang P., Barnes D.T., Cheng R.P., Xu A., Moon Y.J., Kodukula S.S, & Raper J.A. (2022). Netrins and netrin receptors are essential for normal targeting of sensory axons in the zebrafish olfactory bulb. Neuroscience, 508, 19-29.
+ Open protocol
+ Expand
9

Chromogenic and Fluorescent In Situ Hybridization for Mouse Cdh13 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromogenic and fluorescent in situ hybridization were performed according to previously published work.38, 39, 40 The RNA probe was designed to target the sequence between the second and the third exon of mouse Cdh13 mRNA. The primers used to make the probe were: forward 5′ CAACGAGAAGCTGCACTACG 3′ and reverse 5′ GCGCTAATACGACTCACTATAGGGGGACACCACAATGGACCTCT 3′. Mouse brains were sectioned into 18 μm and 60°C was used as incubation temperature for hybridization. For fluorescent in situ hybridization, TSA plus cyanine 5 System (PerkinElmer, NEL745001KT PerkinElmer, Waltham, MA, USA) and TSA plus fluorescein System (PerkinElmer, NEL741001KT) were used for signal amplification. In addition, in situ hybridization analysis performed on tissues after viral transduction utilized hybridization solution containing urea utilized hybridization solution containing urea and 50°C was used for hybridization.
Tantra M., Guo L., Kim J., Zainolabidin N., Eulenburg V., Augustine G.J, & Chen A.I. (2018). Conditional deletion of Cadherin 13 perturbs Golgi cells and disrupts social and cognitive behaviors. Genes, Brain, and Behavior, 17(6), e12466.
+ Open protocol
+ Expand
10

Immunohistochemistry Analysis of Intestine

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunohistochemistry was performed according to standard protocols. Briefly, the intestine was dissected and fixed in 4% PFA O/N at 4 °C before paraffin embedding. Paraffin-embedded sections (5 μm) were rehydrated, and the epitopes were exposed using Tris/ethylenediaminetetraacetic acid (EDTA) buffer. Sections were then incubated in blocking solution (2% donkey or goat serum, 5% DMSO and 0.5% Triton-X-100 in PBS) at room temperature for 2 h. Primary antibody for NOTCH1 (1:100; Abcam, ab52627), β-Catenin (1:50; Sigma, 05-665), or OLFM4 (1:100; Cell Signaling Technology, 39141) was diluted in blocking solution (1% DMSO, 0.5% Triton-X-100 and 2% normal goat serum in PBS) and the sections were incubated in this for 24 h at 4 °C. Sections were subsequently washed and incubated with secondary antibody (1:500; Goat anti-rabbit HRP, Perkin Elmer) and DAPI diluted in blocking solution (1% DMSO, 0.5% Triton-X-100 and 2% normal goat serum in PBS) for 2 h at room temperature with shaking. The TSA kits, TSA Plus Cyanine 5 System (Perkin Elmer, NEL752001KT) were used for visualization.
Yum M.K., Han S., Fink J., Wu S.H., Dabrowska C., Trendafilova T., Mustata R., Chatzeli L., Azzarelli R., Pshenichnaya I., Lee E., England F., Kim J.K., Stange D.E., Philpott A., Lee J.H., Koo B.K, & Simons B.D. (2021). Tracing oncogene-driven remodelling of the intestinal stem cell niche. Nature, 594(7863), 442-447.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!