Z devd fmk

The general caspase inhibitor, Z-VAD-FMK (Enzo Life Sciences) and specific caspase inhibitors, Z-DEVD-FMK (caspase-3 inhibitor), Z-IETD-FMK (caspase-8 inhibitor) and Z-LEHD-FMK (caspase-9 inhibitor) (all from BD Bioscience) were reconstituted in DMSO (Sigma Aldrich) to a stock concentration of 10 mM. Cells were collected, washed with PBS, resuspended in culture medium at final concentration of 0.25 × 10⁶ cells per ml. For apoptosis inhibition, cells were pre-treated with specific inhibitors of caspases (0-200 μM) for 2 h before inducing apoptosis by cytotoxic drugs. PMA (25 ng/ml) or TNF-α (20 ng/ml) were used as positive control HIV-1 activators. The treated cells were incubated for 36 h in 5 % CO₂ and 37 °C in humidified atmosphere. After 36 h cultures were divided and collected in two parts, one for RNA extraction and another for Annexin-V staining.

EVs were dissolved with TRIzol reagent (Thermo Fisher Scientific) and total miRNAs were purified using the miRNeasy mini kit (Qiagen). Twenty µg of EVs were analysed with a 3D-gene miRNA microarray system (Toray). According to the RNA sequences from miRBase, selected DUC18 CD8 EV-dominant miR-298–5p, 1943-5p and 5099; and BALB TB CD8 EV-dominant miR-150-5p, 223-3p and 3470b were synthesised (Hokkaido System Science).
To study of activated caspase-3-mediated apoptosis, pan-caspase inhibitor (Z-VAD-FMK: MedChem Express) or caspase-3 inhibitor (Z-DEVD-FMK: BD Biosciences) was added to the MSC culture at 20 μM with 10 μg DUC18 CD8 EVs. At 2 days after treatment, MSCs were stained with APC-conjugated annexin V and analysed by flow cytometry.
Small RNAs were isolated from EVs using miRNeasy mini kit (Qiagen) according to the manufacturer’s directions. Reverse transcription of RNAs was performed using the Mir-X miRNA First-Strand Synthesis Kit (Clonetech). RT-qPCR was performed using the StepOnePlus Real-Time PCR system (Applied Biosystems) with SYBR Advantage qPCR Premix (Clonetech) and synthetic primers (GeneDesign: miR-298–5p; GGCAGAGGAGGGCTGTTCTTCCC). The quantity of each miRNA was measured by the comparative Ct method (the ^⊿⊿Ct method). The level of each miRNA was normalised to that of a U6 snRNA control.

Before culture splenocytes were washed twice with PBS and labeled with 2.5 µM CFSE (eBioscience) in PBS for 10 min at 37°C, followed by a wash with RPMI-1640 (PAN Biotech) supplemented with 10% FCS (Biochrom). CFSE dilution after 96 h of culture was measured with flow cytometry. Where indicated, the ferroptosis inhibitor Ferrostatin-1 (1 µM, Sigma), cytoplasmic ROS scavenger NAC (N-acetylocysteine, 10 mM, Sigma), necroptosis inhibitor Necrostatin-1 (30 µM, Sigma), mitochondrial ROS scavenger MitoTEMPO (20 µM, Sigma), or the caspsase-3-inhibitor z-DEVD-FMK (20 µM, BD) were added. Iron was added in the form of 5 µM ferric citrate.

Mycobacterium intracellulare 9141 was obtained from the Clinical Mycobacterial Laboratory at National Jewish Health (NJH). The human monocytic cell line THP-1 was obtained from the American Type Culture Collection (Rockville, MD). Fetal bovine serum (FBS) was purchased from Atlanta Biologicals (Lawrenceville, GA) and heat inactivated at 56°C. Reagents for Middlebrook 7H10 solid agar medium or Middlebrook 7H9 liquid medium were purchased from Difco (Detroit, MI). Interferon-gamma (IFNγ), caspase-3 inhibitor benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone (z-DEVD-fmk), BD Vacutainer CPT^TM tubes, and the Human Active Caspase-3 Quantikine ELISA Kit were purchased from R&D Systems (Minneapolis, MN). LysoTracker Red DND-99, Cy3-goat anti-rabbit IgG (H+L), and anti-A20 polyclonal antibody were purchased from Thermo Fisher Scientific/Life Technologies (Carlsbad, CA). Monocyte colony stimulating factor (M-CSF), phorbol myristate acetate (PMA), dimethyl sulfoxide (DMSO), 3-methyladenine (3-MA), and pure AAT were purchased from Sigma Chemical Company (St. Louis, MO). Polyclonal rabbit anti-human LC3B and p62 antibodies were purchased from Cell Signaling Technology (Danvers, MA). The TransAM® NFκB p65 kit was purchased from Active Motif (Carlsbad, CA). AAT (Glassia®) was acquired from Kamada Ltd., Israel.

Femur and tibia pairs were flushed to harvest cells from the bone marrow as previously described (Riley et al., 1991 (link)). Single cell suspensions were washed and counted for use in flow cytometry, cell sorting, or cell culture. When obtaining IL-7 expanded B-cell precursors, bone marrow cells were cultured at 1–2 × 10⁶ cells ml⁻¹ with 5 ng ml⁻¹ rmIL-7 in RPMI-1640 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% FCS (low endotoxin; Sigma–Aldrich, St. Louis, MO, USA) plus 1% penicillin-streptomycin, 1% glutamine, and 5 × 10⁻⁵ m 2-mercaptoethanol.
In analysis of apoptotic mechanisms, a caspase 3 inhibitor, Z-DEVD-FMK (BD Biosciences), was used to block caspase 3 activity with Z-FA-FMK serving as negative control (BD Biosciences) (Ratliff et al., 2013 (link)). Cells were preincubated with inhibitor or control for 30 min. Cells were cultured for the indicated times and assessed for intracellular λ5 protein as described above. Added inhibitor or control was included to maintain original concentrations (50 mm) during culture.

For apoptosis detection, we used the FITC Annexin V Apoptosis Detection Kit I (BD Biosciences), and the analysis was performed according to the manufacturer's instructions. The cell fluorescence was determined by flow cytometry as described above. The protection assays using a caspase-3 inhibitor (Z-DEVD-FMK, BD Biosciences), a p53 inhibitor (cyclic pifithrin-α, Cayman Chemical, Ann Arbor, MI, USA), and an antioxidant N-acetyl-L-cysteine (NAC, Sigma-Aldrich Co.) were performed. In brief, the cells were pretreated for 2 h with 50 μM Z-DEVD-FMK and 10 μM cyclic pifithrin-α and for 1 h with 5 mM NAC, followed by incubation with 14 μM xylopine for 48 h. The cells were then trypsinized and the FITC Annexin V Apoptosis Detection assay was conducted as described above.