For validation of the miRNA deep sequencing results, 10 DEMs (five up- and five down-regulated) were randomly selected, and a portion of the RNA preparations used in miRNA deep sequencing was used for qRT-PCR analysis. Total RNA was treated by RNase-free DNase (Qiagen, Germany) to remove any residual DNA contamination. Reverse transcription of total RNA was performed using TransScript Green miRNA Two-Step qRT-PCR SuperMix (TransGenBiotech, China) according to the recommendations in the product manual. We used TransStart TipGreen qPCR SuperMix (TransGen Biotech, China) to conduct qRT-PCR analysis on an ABI 7300 Real-time PCR system (Applied Biosystems, USA) following reaction conditions suggested by TransGenBiotech. All reactions were analyzed in triplicate. The relative quantification of each miRNA was calculated based on the 2-ΔΔCT method [53 (link)]. All primers are listed in Supplementary Table 6 . A U6 gene was selected as the internal control. IBM SPSS Statistics 22 was employed for statistical analysis.
Transscript green mirna two step qrt pcr supermix
Manufactured by Transgene
Sourced in China
TransScript Green miRNA Two-Step qRT-PCR SuperMix is a laboratory equipment product used for quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis of microRNA (miRNA) expression. The product contains all the necessary reagents for the two-step qRT-PCR process, including reverse transcription and real-time PCR amplification, in a single convenient solution.
Automatically generated - may contain errors
Lab products found in correlation
Easypure mirna kit, by Transgene (5 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Transscript green two step qrt pcr supermix, by Transgene (2 mentions)
Transscript 2 green two step qrt pcr supermix, by Transgene (2 mentions)
Transwell kit, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Transstart tip green qpcr supermix, by Transgene (1 mentions)
Abi 7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Spss statistics 22, by IBM (1 mentions)
Rnase free dnase, by Qiagen (1 mentions)
Revertaid rt reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Beyotime (1 mentions)
Transscript mirna first strand cdna synthesis supermix, by Transgene (1 mentions)
20 protocols using transscript green mirna two step qrt pcr supermix
1
Validation of miRNA Deep Sequencing
2
Quantitative Analysis of Gene Expression in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, MA, USA) was applied to extract total RNA from gastric cancer cell lines and tissues following the manufacturer’s instructions and stored at −80°C. RNA concentration and purity were measured using a Nanodrop spectrophotometer. The OD260/280 ratios for all samples were between 1.8 and 2.0. Total RNA (4 μg) was reverse-transcribed into cDNA using a RevertAid RT Reverse Transcription Kit (Thermo Fisher Scientific, MA, USA). The qRT-PCR assays were conducted on an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, CA, USA) using TransScript® Green miRNA Two-Step qRT-PCR SuperMix (Transgen Biotech, Beijing, China). GAPDH and U6 small nuclear RNA were used as the internal controls. The comparative cycle threshold (2−ΔΔCT) method was applied to calculate relative gene expressions [28 (link)]. The primer sequences are shown in Supplementary Table 1 .
3
Gene Expression Profiling by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol (Beyotime, Beijing, China). The complementary DNA was synthesized using the EasyScript® First-Strand cDNA Synthesis SuperMix (Transgen, Beijing, China) and TransScript® miRNA First-Strand cDNA Synthesis SuperMix (Transgen) based on the instructions of the manufacturer. Afterwards, RT-PCR was carried out with the TransScript®Green Two-Step qRT-PCR SuperMix (Transgen) or TransScript® Green miRNA Two-Step qRT-PCR SuperMix (Transgen). The primer sequences were as follows: FOXD2-AS1-sence: 5′-TGGACCTAGCTGCAGCTCCA-3′, antisense: 5′-AGTTGAAGGTGCACACACTG-3′; miR-185-5p-sense: 5′-GCGGCGGTGGAGAGAAAGGCAG-3′, antisense: 5′-ATCCAGTGCAGGGTCCGAGG-3′; ROCK2-sence: 5′-AACGTCAGGATGCAGATGGG-3′, antisense: 5′-CAGCCAAAGAGTCCCGTTCA-3′; GAPDH-sence: 5′-GTTGCAACCGGGAAGGAAAT-3′, antisense: 5′-GCCCAATACGACCAAATCAGA-3′ and U6-sence: 5′-CAGCACATATACTAAAATTGGAACG-3′, antisence: 5′-ACGAATTTGCGTGTCATCC-3′.
4
Comprehensive Molecular Assays for Cell Biology
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
There was RIPA reagent (Thermo Fisher Scientific, U.S.A., 89901), protein extraction reagent (Thermo Fisher Scientific, U.S.A., 87787), ECL fluorescence kit (Thermo Fisher Scientific, U.S.A., 32209), trypsin (Thermo Fisher Scientific, U.S.A., 25300120), Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, U.S.A., 11668019), TransScript II Green Two-Step qRT-PCR SuperMix, TransScript Green miRNA Two-Step qRT-PCR SuperMix (TransGen Biotech, Beijing, AQ301-01, AQ202-01), CCK-8 kit (Shanghai Yisheng Biotechnology Co., LTD., 40203ES60), Transwell kit (Gibco, U.S.A., 1142802), DMEM (Thermo Fisher Scientific, U.S.A., A2493901), PBS (Thermo Fisher Scientific, U.S.A., 20012050), fetal bovine serum (Thermo Fisher Scientific, U.S.A., 10099141C), Penicillin–Streptomycin (Gibco, U.S.A., 15070063), Annexin V/PI apoptosis assay kit (Shanghai Yisheng Biotechnology Co., LTD., 40310ES60), double luciferin reporter gene assay kit (Promega, U.S.A.) and CEZMagna RIP kit (Millipore, Billerica, MA, U.S.A.).
5
Profiling Exosomal miRNAs in Bladder Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRNA profiles of T24 and SV-HUC-1 cell were identified by next-generation sequencing. By comparison to the SV-HUC-1 exosomal miRNA profile, the aberrant expressed miRNAs in T24 cell derived exosomes were identified and verified.
According to the sequencing data, miR-146-3p is the most abundant miRNA in T24 exosomes with a large number of reads and significant up-regulated expression compared to the exosomes of the SV-HUC-1 cell. The other highly expressed miRNAs in T24 exosomes are miR-100-5p, miR-21-5p, miR-21-3p, miR-30a-5p, let-7i-5, miR-221-3p, miR-22-3p, miR-186-5p, miR-28-3p, and miR-378a-3p. The expression of this group of miRNAs in T24 exosomes was verified by the q-PCR method following the instruction of EasyPure miRNA Kit (Transgen Biotech, Beijing, China) and TransScript Green miRNA Two-Step qRT-PCR SuperMix (Transgen Biotech, Beijing, China). The q-PCR circle was implemented in CFX96 Touch qPCR System (Bio-Rad Laboratories, Hercules, CA, USA). Small RNA U6 was used as an internal reference gene, and the 2−ΔΔCt method [53 (link)] was used to calculate the relative expression ratio of each miRNA in T24 exosome. The specific primers and the expression of miRNAs in BC exosomes are shown in our previous study [40 (link)].
According to the sequencing data, miR-146-3p is the most abundant miRNA in T24 exosomes with a large number of reads and significant up-regulated expression compared to the exosomes of the SV-HUC-1 cell. The other highly expressed miRNAs in T24 exosomes are miR-100-5p, miR-21-5p, miR-21-3p, miR-30a-5p, let-7i-5, miR-221-3p, miR-22-3p, miR-186-5p, miR-28-3p, and miR-378a-3p. The expression of this group of miRNAs in T24 exosomes was verified by the q-PCR method following the instruction of EasyPure miRNA Kit (Transgen Biotech, Beijing, China) and TransScript Green miRNA Two-Step qRT-PCR SuperMix (Transgen Biotech, Beijing, China). The q-PCR circle was implemented in CFX96 Touch qPCR System (Bio-Rad Laboratories, Hercules, CA, USA). Small RNA U6 was used as an internal reference gene, and the 2−ΔΔCt method [53 (link)] was used to calculate the relative expression ratio of each miRNA in T24 exosome. The specific primers and the expression of miRNAs in BC exosomes are shown in our previous study [40 (link)].
6
Quantitative Analysis of miR-155 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fasting peripheral vein blood was collected and centrifuged at 3000 rpm/min for 10 min after stored for 30 min at 4℃. Total RNA was extracted from the obtained supernatant fluid using TRIzol kit (Invitrogen, Waltham, USA). Agarose gel electrophoresis and ultraviolet spectrophotometry were employed to detect its concentration, purity and integrality. The reverse transcription was performed with TransScript Green miRNA Two-Step qRTPCR SuperMix (AQ202-01, Beijing TransGen Biotech Company, China). The qRT-PCR amplified system was 20 μL, including 1 μL of cDNA, 0.8 μL of upstream and downstream primers (each 0.4 μL), 10 μL of 2×TransTaq® Tip Green qPCR SuperMix, 0.4 μL of Passive Reference Dye (50×) and 7.8 μL of ddH2O. The qRT-PCR amplification procedures were as follows: 30s of initial denaturation at 94℃, 5 s of degeneration at 94℃, and 30s of annealing and extending at 60℃, with a total of 40 cycles. The expression level of miR-155 was assessed through the 2–ΔΔCt method with U6 as an internal parameter.
7
Gastroenterological Biomarker Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gastrin (GAS), vasoactive intestinal peptide (VIP), serum motilin (MTL), and cholecystokinin (CCK), Trizol agent and miRNA reverse transcriptase kit were all purchased from Co., Ltd. Trizol agent and miRNA reverse transcriptase kit were both from Invitrogen Company. The EasyPure miRNA kit was from Beijing TransGen Biotech Company, China (ER 601-01). Transscript Green miRNA Two-Step qRT-PCR SuperMix was from Beijing TransGen Biotech Company, China (AQ202-01). KH19A desktop high-speed and high-performance centrifuge was from KAIDA Company. The low-temperature refrigerator (−80°C) was from ThermoFisher Scientific Company. The primer sequence of miR-152 was devised and compounded by Sangon Biotech (Shanghai) Co., Ltd. (Table 1 ).
8
Quantitative Analysis of miR-873-5p and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cells was extracted by using TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc.). To detect miR-873-5p expression, reverse transcription and qPCR were performed by using TransScript Green miRNA Two-step qRT-PCR SuperMix (TransGen, Beijing, China). For mRNA expression, RNA was reverse transcribed into cDNA using TransScript First-Strand cDNA Synthesis superMix (TransGen) and qPCR was conducted by TransStart Green qPCR SuperMix (TransGen). The qPCR reaction was composed of 94°C for 30 s, followed by 40 cycles of 94°C for 5 s and 60°C for 30 s on ABI Prism 7700 (Applied Biosystems, Foster City, CA, USA). The miR-873-5p expression was normalized to U6 and other mRNA expression was normalized to GAPDH. The fold change was calculated using the 2–ΔΔCt method.12 (link) The sequences of the primers were miR-873-5p, forward 5ʹ-GCAGGAACUUGUGAGUCUCCU-3ʹ and reverse 5ʹ-AGGAGACUCACAAGUUCCUGC-3ʹ; U6, forward 5ʹ-GCTTCGGCAGCACATATACTAAAAT-3ʹ and reverse 5ʹ-CGCTTCACGAATTTGCGTGTCAT-3ʹ; CXCL16, forward 5ʹ-ACTCAGCCAGGCAATGGCAAC-3ʹ and reverse 5ʹ-GGTATTAGAGTCAGGTGCCAC-3ʹ; GAPDH, forward 5ʹ-CTGGTCACCAGGGCTGCTTTT-3ʹ and reverse 5ʹ-CATGAGGTCCACCACCCTGTT-3ʹ.
9
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The blood samples stored at −80°C were taken out, and the total RNA of tissues was extracted by the TRIzol kit. The purity, concentration, and integrality of the obtained general RNA were tested via ultraviolet spectrophotometry and agarose gel electrophoresis. TransScript Green miRNA Two-Step qRT-PCR SuperMix (AQ202-01, Beijing TransGen Biotech Company, China) was applied for a reverse transcript of the extracted general RNA. The test was conducted according to the kit instructions, and the cDNA was collected for the PCR amplified experiment. The qPCR amplified system was as follows: cDNA (1 μL), upstream and downstream primers (each 0.4 μL), 2 × TransTaq® Tip Green qPCR SuperMix (10 μL), and Passive Reference Dye (50X) (0.4 μL). In the end, ddH2O was added to complete to 20 μL. The qPCR-amplified procedures were initial denaturation at 94°C for 30 s, degeneration at 94°C for 5 s, and annealing and extending at 60°C for 30 s, with 40 cycles. Three duplicate holes were established for each specimen, and the test was conducted 3 times in total. In this research, U6 was applied as an internal parameter and 2−△ct was applied to analyze this data. GAS, VIP, MTL, and CCK were obtained in strict accordance with ELISA kit specifications.
10
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs in brain tissues and cells were isolated using Trizol reagent (Solarbio, Tongzhou District, Beijing, China). RNA concentration and purity were measured spectrophotometrically. The relative mRNA and miRNA expression levels were measured using 100 ng RNA as the template and the TransScript® Green Two-Step qRT-PCR SuperMix (Transgen, Beijing, China) and the TransScript Green miRNA Two-Step qRT-PCR SuperMix (Transgen, Beijing, China), respectively, on a 7500 FAST Real-Time PCR System (Bio-Rad Co., USA). The primers for miR-126a-5p, NOX2, U6, and GAPDH were listed in Table 1 . The relative expression was evaluated using the 2−ΔΔCt method, and data were presented as the ratio of miR-126a-5p to U6 or NOX2 mRNA to GAPDH mRNA.
Sequences of Primers Used in qRT-PCR
| Gene | Forward Primer (5ʹ-3ʹ) | Reverse Primer (5ʹ-3ʹ) |
|---|---|---|
| miR-29b-5p | CGTAGCACCATTTGAAATCAGTGTT | GTGCAGGGTCCGAGGT |
| miR-188-3p | ATTATTGGCTCCCACATGCAGGG | ATCCAGTGCAGGGTCCGAGG |
| miR-532-3p | CGGCCATGCCTTGAGTGTA | GCAGGGTCCGAGGTATTC |
| miR-150-5p | GCGTCTCCCAACCCTTGTA | AGTGCAGGGTCCGAGGTATT |
| miR-126a-5p | GGGGGCATTATTACTTTTGG | GTGCGTGTCGTGGAGTCG |
| miR-327 | TGCGCCCTTGAGGGGCATG | CCAGTGCAGGGTCCGAGGTATT |
| U6 | GCTTCGGCAGCACATATACTAAAAT | CGCTTCACGAATTTGCGTGTCAT |
| NOX2 | ACAAGGTTTATGACGATGAGCC | TTGAGCAACACGCACTGGAA |
| GAPDH | GGAGCGAGATCCCT CCAAAAT | GGCTGTTGTCATACTTCTCATGG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!