Q5 master mix

Pooled next-generation sequencing (NGS) screening was conducted as described in the results and depicted in Fig. 2a. Once FAC sorted via their MedFI, the DNA was extracted from each population. Cells were lysed for 4 h at 55 °C in DNA lysis buffer (50 mM Tris pH 8, 100 mM NaCl, 10 mM EDTA, 1% SDS and 0.5 mg/ml proteinase K (Thermo, EO0491)). After 4 h, DNA was precipitated using an equal volume of isopropanol and resuspended in TE. The gDNA was quantified using quBit, and the whole sample was used in multiple PCRs to enrich gRNA cassettes (2 µg DNA, 1.5 µL 10 µM primers, 25 µL Q5 master mix (NEB, M0492S)).

Pi7_PLVPBnewSeq	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTCGGTGCCACTTTTTCAA
Pi5_PLVPBnobarcode	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCTTGTGGAAAGGACGAAACA

The PCRs were pooled, bead purified, and the product was used in a second PCR to add index adaptors (25 µL KAPA HiFi Hot start ready mix, 1 µL 10 µM primers i5 and i7 combinations). The product was quantified using the NEBNext Library Quant Kit for Illumina (NEB, E7630S) diluted to 4 nM and sequenced by NextSeq (Illumina) using the manufacturer’s instructions for NextSeq 500/550 High Output Kit 75 Cycles (Illumina, 20024906).

cDNA was synthesized from 500 ng of RNA using the Superscript III First Strand Synthesis Supermix (Invitrogen) following the manufacturer’s instructions. Negative controls were included which replaced the enzyme with water. cDNA was diluted 1:4 in nuclease free water. RT-PCR reactions were assembled using NEB Q5 Mastermix (Lctra, dsxF, dsxM, 28S) or NEB OneTaq HS Mastermix (fru) using 1 μl of diluted cDNA.
qRT-PCR was conducted as previously described [18 (link)] with the exception that cDNA was generated from 500 ng of RNA instead of 3.5 μg. This change was due to the lower amount of RNA isolated from a single pupa. The primer pairs for the L. cuprina 28S reference gene and X-linked genes (Lcaru, Lcmav, LcCG1909, Lcgw, Lczfh2) were previously described [17 (link),18 (link)]. qRT-PCR primers for evaluating Lctra expression were designed upstream of the LctraIR inverted repeat region (S2 Table). The raw Ct values for qPCR and qRT-PCR data shown in Figs 3–6 are provided in S4 Table.

Seventy-five percent of the edited cells (~500,000 cells) were collected every two days from day 20 to day 38 after cell sorting and washed once in a PBS buffer solution. Genome extractions were carried out according to the instructions of the kit (DP304, Tiangen, Beijing, China) and eluted with 80 μL distilled water for downstream analysis. Amplification of edited loci was performed with the locus-specific primer pairs described in Table S2 (Supplementary Materials) using 2 × Q5 master mix (M0494L, New England Biolabs, Ipswich, MA, USA) and 200 ng of genomic DNA. The thermocycler was set for one cycle at 98 °C for 30 s, 35 cycles at 98 °C for 15 s, 60 °C for 15 s, and 72 °C for 10 s, respectively, and one cycle at 72 °C for 1 min, and held at 4 °C. PCR amplicons were run on a 1.5% agarose gel to verify the size and purity, and quantified by nanodrop. The resulting DNA was used for direct analysis or reamplified with primers containing Illumina adaptors.

RH-18 cells were cultured in RPMI 1640 medium containing 10% FCS. Cells are all maintained in humidified incubator with 5% CO2 at 37°C. Rh18 cells were exposed to 0.5% DMSO or SD6 10 μM, Cpd1 10 μM, Cpd2 5 μM or Cpd3 10 μM for 4 h. Total RNA was extracted and converted to cDNA. PCR was performed using NEB Q5 Master Mix and specific primers listed below (Table 2) according to the manufacturer’s instruction and standard PCR protocols: 50 ng cDNA and 30 μl of the final reaction volume was used. PCR products were subjected to 3% agarose gel electrophoresis.