CRISPR targeting oligos designed for human SEL1L (#1 ACTGCAGGCAGAGTAGTTGC, #2 GACATCAGATGAGTCAGTAA) and human OS9 (5’GCAAGTCTGACCGGCGGTGTC) were inserted into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene 42230). Oligos targeting mouse Xbp1 (GCTCATGGTACCCGGTCCGC) and mouse Ire1α (CTTGTTGTTTGTCTCGACCC) were used in m-ICc12 cells. Cells were co-transfected with CRISPR constructs, together with the pBabe-puro vector, and selected with 2 or 3 µg/ml puromycin (Invitrogen) for 48 h. Surviving cells were plated to 96-wells with one cell per well for single colony selection. Knockout efficiency in HEK293T cells was assessed by Western blot analysis. In m-ICc12 cells, knockout lines were sequenced using primer sets GCCCCCAAAGTGCTACTCTTA and CCGTGAGTTTTCTCCCGTAA for Xbp1 and TTTTGGAAGAACCAGCACAG and GCCAGTCAGGAGGTCGATAA for Ire1α.
Px330 u6 chimeric bb cbh hspcas9 vector
Manufactured by Addgene
Sourced in United States
The PX330-U6-Chimeric_BB-CBh-hSpCas9 vector is a plasmid-based tool designed for CRISPR/Cas9 genome editing. It contains the hSpCas9 gene under the control of the CBh promoter and a U6 promoter-driven chimeric single guide RNA (sgRNA) expression cassette. This vector enables the expression of the Cas9 endonuclease and a customizable sgRNA to facilitate targeted genomic modifications.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by Thermo Fisher Scientific (2 mentions)
Pbabe puro vector, by Thermo Fisher Scientific (2 mentions)
Amaxa nucleofector, by Lonza (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Pmaxgfp plasmid, by Lonza (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Merck Group (1 mentions)
Puromycin, by Addgene (1 mentions)
Pet 28b cas9 his, by Addgene (1 mentions)
Mtt assay, by Promega (1 mentions)
Px330, by Addgene (1 mentions)
Pdr274, by Addgene (1 mentions)
Plko 1 blast vector, by Addgene (1 mentions)
Hoechst 33342, by Thermo Fisher Scientific (1 mentions)
Moflo astrios eq, by Beckman Coulter (1 mentions)
18 protocols using px330 u6 chimeric bb cbh hspcas9 vector
1
CRISPR-Mediated Gene Knockout in Mammalian Cells
2
CRISPR-Mediated Deletion of Chst8 Enhancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to delete the Chst8 viewpoint (VP) enhancer, primer pairs of gRNA (Supplementary Table 1 ) were designed flanking the mm10 coordinates chr7:34846279-34849157 using the online tool http://crispr.mit.edu/ . Selected primer pairs have an off-target score of 80 (left) and 90 (right) and an on-target score of 69 (left) and 65 (right). gRNAs were cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene #42230) using BbsI sites. Plasmids were nucleofected in NSCs with an Amaxa Nucleofector (Lonza) following manufacturer instructions. After puromycin selection (0.8 ug/ml) and detection analysis with conventional PCR, heterogeneous population carrying a majority of homozygotic deletions was used for experiments.
3
CRISPR-Cas9 Targeting of DYRK1A in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DYRK1A targeting was performed using CRISPR–Cas9. The sgRNA sequence was designed using CRISPR Direct (http://crispr.dbcls.jp/ ; Supplementary Table 4 ). The sgRNA oligos were cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene). On the day before transfection, iPSC colonies were dissociated into single cells using TrypLE Express with 10 µM ROCK inhibitor. Cells were dissociated with TrypLE Express, after which 1.0 × 106 cells were mixed with CRISPR–Cas9 (2 µg) and the donor vector (6 µg), and electroporated using the Neon Transfection System (settings: 1200 V, 20 ms, 2 pulses). The electroporated cells were plated in 10-cm dishes with DR-4 IRR MEFs (Thermo Fisher Scientific). On day 4, drug selection with hygromycin (75 µg mL−1) was initiated. The resulting colonies were selected on days 12–18. PCR-positive clones were further expanded. Primer sequences used for genome editing are listed in Supplementary Table 5 .
4
CRISPR/Cas9 Construct Generation and Cell Clone Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate CRISPR/Cas9 constructs, we annealed target-specific DNA sequences and inserted them into a BbsI-digested pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene plasmid #42230) (Cong et al., 2013 (link); Ran et al., 2013 (link)). One µg of each pX330-gRNA plasmid plus 0.1 µg of pmaxGFP plasmid (Lonza) were transiently transfected into exponentially growing cells using Lipofectamine 2000 (Invitrogen). Three days after transfection, single GFP-positive cells were sorted into 96-well plates and cultured until colonies formed. The genomic DNA from individual cell clones was extracted using QuickExtract DNA Extraction Solution (Lucigen) and screened by PCR for the deletion amplicon using the DNA primers listed in Supplementary file 1 . In the case of HCT116 cells, we repeated the above-described process using two different heterozygous clones with a new downstream gRNA to obtain homozygous TP53 dUTR cells. Finally, to validate positive cell clones, all TP53 alleles of candidate clones were sequenced (Figure 1—figure supplement 1A ).
5
Generation of Sass6 Knockout mESC Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the generation of the CRISPR/Cas9-mediated Sass6 knockout mESCs line, a pair of gRNAs targeting the 5′ and 3′ ends of the entire Sass6 ORF (Figure 2—figure supplement 1 and Table 2 ) were cloned as double-stranded oligo DNA into BbsI and SapI sites in pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene; Watertown, MA, USA) modified with a Puro-T2K-GFP cassette containing puromycin-resistance by Dr. Leo Kurian’s research group (Center for Molecular Medicine Cologne). mESCs in suspension were transfected with the modified pX330 vector containing the pair of gRNAs using Lipofectamine 3000 (Thermo Fisher Scientific). The cells were then subjected to selection using puromycin (2 μg/ml, Sigma-Aldrich; St. Louis, MO, USA) 24 hr post-transfection for 2 days. After recovery for 5 days, individual colonies were picked and screened for the Sass6 locus deletion by PCR (Figure 3A and Table 2 ; Supplementary file 1 ). The cells were used for experiments after four passages.
6
Optimizing CRISPR-Cas9 Genome Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target sites for genome editing were determined by using the CRISPR Design Tool from MIT or Benchling. sgRNAs were cloned with BstXI/NheI restriction/ligation into the pgRNA-humanized plasmid (Addgene plasmid 42230). Cas9 sequence was obtained from pX330-U6-Chimeric_BB-Cbh-hSpCas9 vector (Addgene plasmid 46911) and cloned via Gibson assembly into pcDNA3.1 vector. The SV40 large T-antigen nuclear localization sequence (NLS) and sequences for coiled coils were introduced into the constructs with PCR. Sequence for human exonuclease I (ExoI; Genscript RC200547), human Werner syndrome ATP-dependent helicase (human WRN; Addgene 46038), mouse TREX2 (Addgene 40210), E.coli exonuclease III (ExoIII; Addgene 46884) and human flap structure-specific endonuclease 1 (human FEN1; Addgene 35027) were transferred into pcDNA3.1 plasmid via Gibson assembly. For recombinant protein isolation, pET-28b-Cas9-His (Addgene plasmid 47327) was used as a template, where again coiled-coils were introduced with PCR. For Cas12a the pTE4398 (Addgene; plasmid 74042) vector was used.
7
Generating Enhancer-Deleted HCT-116 Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate enhancer deleted HCT-116 clones, guide RNAs (gRNAs) were designed using the online CRISPR design tool (http://crispr.mit.edu/ ) [45 ] and cloned into a modified px330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Cambridge, MA, USA) harboring a Venus fluorescent protein cassette. For each enhancer deletion two vectors coding for gRNAs surrounding the enhancer locus were transfected into HCT-116 cells. A day after transfection, GFP positive cells were sorted by fluorescence-activated cell sorting (FACS) and single plated into 96 well plates. 10 days after plating, the colonies were genotyped by genomic PCR to find clones with the desired deletions. The primers listed in Table S3 were used to generate the different px330 vectors used in this study.
8
CRISPR-Mediated Gene Knockout in Mammalian Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR targeting oligos designed for human SEL1L (#1 ACTGCAGGCAGAGTAGTTGC, #2 GACATCAGATGAGTCAGTAA) and human OS9 (5’GCAAGTCTGACCGGCGGTGTC) were inserted into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene 42230). Oligos targeting mouse Xbp1 (GCTCATGGTACCCGGTCCGC) and mouse Ire1α (CTTGTTGTTTGTCTCGACCC) were used in m-ICc12 cells. Cells were co-transfected with CRISPR constructs, together with the pBabe-puro vector, and selected with 2 or 3 µg/ml puromycin (Invitrogen) for 48 h. Surviving cells were plated to 96-wells with one cell per well for single colony selection. Knockout efficiency in HEK293T cells was assessed by Western blot analysis. In m-ICc12 cells, knockout lines were sequenced using primer sets GCCCCCAAAGTGCTACTCTTA and CCGTGAGTTTTCTCCCGTAA for Xbp1 and TTTTGGAAGAACCAGCACAG and GCCAGTCAGGAGGTCGATAA for Ire1α.
9
Generation of VIP36-Knockout Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human VIP36-KO vector was prepared as follows. The purified products obtained from the BbsI (#R0539, New England Biolabs)-digested pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Plasmid #42230, Addgene, Watertown, MA, USA) that contains a puromycin-resistance gene were ligated with hVIP36 sgRNA-forward 5′-caccgCAGGGGTCAGACGTACGTAC-3′ and hVIP36 sgRNA-reverse 5′-aaacGTACGTACGTCTGACCCCTGc-3′.
10
CRISPR-Cas9 Screening for WNV Resistance
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!