The TRIzol method was used to extract the total RNA of lentivirus-coated cells, and the RNA was reverse transcribed into cDNA using a reverse transcription kit (Novoprotein, China). The hsa_circ_7042/mmu_circ_7042, CDH2/CDH2, and BMP2/BMP2 levels were tested according to the instructions of the NovoStart® SYBR qPCR SuperMix Plus kit (Novoprotein, China). Expression of the Acan and Col2a1 genes was detected, and GAPDH/GAPDH was used as an internal control. miR-369 was obtained by following the instructions of the one-step miRcute miRNA kit (Qiagen, Germany). Using U6 as an internal reference, the expression of miR-369 was detected using TransScript® Green miRNA Two-Step qRT–PCR SuperMix (TransScript, China). The formula 2−ΔΔCt was used to determine the relative expression levels of genes, and each sample was repeated 3 times. The qPCR primer sequences are as follows: see Supplementary material 1 , Table S1.
Reverse transcription kit
Manufactured by Novoprotein
Sourced in China
The Reverse Transcription Kit is a laboratory tool used for the conversion of RNA to complementary DNA (cDNA). The kit contains the necessary reagents and enzymes to perform this reverse transcription process, which is a fundamental step in various molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Sybr qpcr supermix plus, by Novoprotein (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Novostart sybr qpcr supermix plus kit, by Novoprotein (1 mentions)
Rnase free ddh2o, by Takara Bio (1 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Novostart sybr qpcr supermix plus, by Novoprotein (1 mentions)
Sybr qpcr supermix plus kit, by Novoprotein (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Real time pcr system, by Thermo Fisher Scientific (1 mentions)
Transstart top green qpcr supermix, by Transgene (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
Sybr green mix, by Selleck Chemicals (1 mentions)
Trizol kit, by Takara Bio (1 mentions)
Rneasy rna extraction kit, by Qiagen (1 mentions)
Sybr green based qpcr kit, by Novoprotein (1 mentions)
12 protocols using reverse transcription kit
1
Quantitative analysis of circRNAs, mRNAs, and miRNAs in lentivirus-coated cells
2
Spatial Expression of ZmbZIP107 in Maize
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nine tissues were collected from maize line B73 and subjected to expression analysis of ZmbZIP107, including roots (three-leaf stage and silking stage), leaf (three-leaf stage and silking stage), stems (silking stage), female flowers, male flowers, grains on the 6th day after pollination (6 DAP) and 12 DAP. Moreover, maize seedlings were cultured in Hoagland solutions supplemented with 1mM Pb(NO3)2 and without Pb(NO3)2 for seven days, respectively. The shoots and roots were individually sampled for total RNA extraction by using TRIzol Reagent (Invitrogen, California, USA). The first-strand cDNA was synthesized from 2 µg total RNA using a reverse transcription kit (Novoprotein, Nanjing, China) following the manufacturer’s instruction. The gene expression level of ZmbZIP107 was quantified by performing RT-qPCR with SYBR qPCR SuperMix Plus (Novoprotein, Nanjing, China). The OsActin gene was used an internal reference, and the 2-ΔΔCT method was used to calculate the relative expression levels of ZmbZIP107 (Chen et al., 2021 (link)). Three biological replicates and three technical replicates were included for each sample.
3
Validation of Candidate Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The candidate proteins were verified by confirming the transcription levels identified using qRT-PCR. A total of 12 proteins (6 upregulated and 6 downregulated proteins) were randomly selected and measured. Total RNA of plerocercoids and adults was extracted using TRIzol reagent (Invitrogen, USA) based on the manufacturer’s instructions. RNA was dissolved in RNase-free ddH2O (Takara, China), and cDNA was synthesized using a reverse transcription kit (Novoprotein, Shanghai, China). The reverse transcribed first-strand cDNA was used as a template for real-time PCR. Primers used for RT-PCR were synthesized by Sangon Biotech (Shanghai, China) (Additional file 2 : Table S2). RT-PCR was performed on an Applied Biosystems 7500 Fast Real Time PCR System (Applied Biosystems, USA). GAPDH was used as a housekeeping gene. Statistical differences between two groups were analysed using Student’s t-test with significant differences at P < 0.05.
4
Nile Tilapia Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from spleen, head kidney, trunk kidney, liver, intestine, gill and peripheral blood of Nile Tilapia using TRIzol reagent (Invitrogen). The extracted RNA was synthesized into cDNA using reverse transcription kit (Novoprotein). The synthesized cDNA was diluted at 1:30 as the template and β-actin was used as the internal reference gene. The relative mRNA levels of target genes were detected by 2 × NovoStart SYBR qPCR SuperMix Plus (Novoprotein), and the relative expression levels of target genes were calculated by 2−△△CT method. The gene-specific primers used in this study are listed in Table S2.
5
Quantitative Analysis of SLC35A2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Novoprotein Scientific Inc. provided both the reverse transcription kit (catalog number E047) and the qPCR kit (catalog number E096), and the primers were designed and synthesized by General Biol (Anhui) Co., Ltd. Cells were extracted with the RNA extraction kit (catalog number R4111) based on Magen’s instructions. The RNA extracted in the last step was transformed into cDNA by reverse transcription kit, and then Hot-Star Taq was premixed by SYBR, and RT-qPCR was performed on Roche Applied Science Light Cycler 480. Use the following primers: SLC35A2-F, 5′-GAATGGCCTCCATCCCAG-3′; SLC35A2-R, 5′- CCTTTGAGCACTTCCGCCAT-3′; GAPDH processed all results for standardization. The 2−ΔΔ Ct method was used to calculate the gene’s relative expression level.
6
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells using an Ultra-Pure Total RNA Extraction Kit (Simgen, Zhejiang, China) and reverse-transcribed to cDNA using a Reverse Transcription Kit (Novoprotein, Jiangsu, China). The primers were synthesized by Beijing Tsingke Biotechnology Co. (Table 1 ). qRT-PCR was then performed to amplify the cDNA template using the SYBR qPCR SuperMix Plus Kit (Novoprotein, Jiangsu, China) and the CFX96 real-time PCR System (Bio-Rad, CA, USA). The experiment was repeated thrice. Gene expression was calculated using the 2−ΔΔCt method and normalized to the internal control, GAPDH.Table 1
PCR primer sequences.
| Forward sequence (5′–3′) | Reverse sequence (5′–3′) | |
|---|---|---|
| Ki67 | CTTTGGGTGCGACTTGACGA | ACAACTCTTCCACTGGGACG |
| MCM2 | GCGAAACCTGGTTGTTGCTG | AGGATTCCGATGATTCCGCC |
| MMP2 | GATACCCCTTTGACGGTAAGGA | CCTTCTCCCAAGGTCCATAGC |
| MMP9 | CATTCAGGGAGACGCCCATT | AACCGAGTTGGAACCACGAC |
| VEGFA | AGGGCAGAATCATCACGAAGT | AGGGTCTCGATTGGATGGCA |
| PCNA | GGTTACTGAGGGCGAGAAGC | GACCGGCTGAGACTTGCGTA |
| GAPDH | AATGGGCAGCCGTTAGGAAA | GCCCAATACGACCAAATCAGAG |
7
Quantitative Expression Profiling of Schistosome GSTs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR (qRT-PCR) analysis was performed to monitor the expression levels of identified SmGSTs in two life cycle stages of S. mansoni: plerocercoid stage and adult stage (including immature proglottide, mature proglottide and gravid proglottide). The gene-specific primers are listed in Supplementary Table S1 . Total RNA was isolated using a reverse transcription kit (Novoprotein, Shanghai, China). qRT-PCR was conducted on a 7,500 Fast Real-time PCR system (Applied Biosystem, Monza, Italy). The reaction mixture contained 10 μL of 2 × TB Green Premix Ex Taq (Takara, Beijing, China), 10 μM each of sense and antisense primers, 100 ng of first-strand cDNA. Initial thermal-cycling at 95°C for 30 s followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. The GAPDH gene was served as the internal control (26 (link)). Relative gene expression levels were analyzed according to the comparative 2−ΔΔCT method (27 (link)).
8
Quantifying EIF5A2 Expression in HNSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 16 matched HNSCC and normal samples using TRIzol (Invitrogen, USA) before conversion to cDNA via a reverse transcription kit (Novoprotein, China). qRT‐PCR was carried out in a LightCycler 480 (Roche, USA) system mixed with NovoStart® SYBR qPCR (Novoprotein, China). The PCR conditions were as follows: heating at 95°C for 30 s, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; the reaction lasted for 35 cycles. The housekeeping gene glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as an endogenous control. The EIF5A2 primers were EIF5A2‐F: 5′‐TGTCCTTCTACTCACAACATGGA‐3′, EIF5A2‐R: 5′‐CTCACGAACTTCACCAGTTTCT‐3′, GAPDH‐F: 5′‐CAGTCAGCCGCATCTTCTT‐3′, GAPDH‐R: 5′‐GACAAGCTTCCCGTTCTCAG‐3′. The EIF5A2 relative expression was computed via the 2−ΔΔCt formula. All experimentations were completed thrice.
9
Analyzing Gene Expression in Fungus C. globosum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mycelium pellets in the PDA broth were filtered and washed twice with sterile water. After absorbing the water with filter paper, the mycelium pellets were transferred to the mortar, mixed with liquid nitrogen, and ground to powder. The RNA was extracted by using the RNA prep pure plant kit (Tiangen, China) and translated into cDNA using a reverse transcription kit (Novoprotein Scientific Inc, China). The RNA quality was analyzed by agarose gel electrophoresis, and 10-fold diluted cDNA was employed as template to perform quantitative real-time PCR (RT-qPCR) using Trans Start Top Green qPCR SuperMix (TransGen Biotech, China) in a Real-time PCR System (Thermo Fisher Scientific, Carlsbad, CA, USA). The β-actin gene (GenBank Accession No. CH408033.1 ) was used as an internal control for C. globosum. The relative abundances of CgVeA, LaeA, cheR, PKS, and p450 genes were standardized by the expression levels of the β-actin gene, and the relative quantification of each transcript was achieved using the 2−ΔΔCT method [35 (link)]. The enumerations were performed in triplicate for each group of data, and the average was taken into consideration.
10
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using a TRIzol kit (TaKaRa, Japan), and cDNA was synthesized using a reverse transcription kit (Novoprotein, China). RT-qPCR was performed using the SYBR Green Mix (Bimake, USA). The primer sequences are listed in Supplementary Table S2. Gene expression levels were quantified using the 2−ΔΔCT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!