Primary keratinocytes and early passage MEFs from Mdm2SNP309G/G and Mdm2SNP309T/T mice were generated as previously described (21 (link), 55 (link)). Early passage MEFs were transfected with 7 µg of pCMV-GFP vector containing E2F4 cDNA, E2F6 cDNA, SP1 cDNA, or empty vector using Lipofectamine 3000 reagent (Sigma, L3000015). Forty-eight hours later, GFP positive cells were sorted by FACS and RNA was extracted for RT-PCR analysis.
Lipofectamine 3000 reagent
Manufactured by Merck Group
Sourced in United States
Lipofectamine 3000 reagent is a cationic lipid-based transfection agent used for the delivery of nucleic acids, such as plasmid DNA, mRNA, and siRNA, into a variety of mammalian cell lines. It is designed to efficiently transfect cells with high viability and low toxicity.
Automatically generated - may contain errors
Lab products found in correlation
Oligofectamine, by Merck Group (2 mentions)
Smartpool reagents, by GE Healthcare (2 mentions)
Fetal calf serum (fcs), by Lonza (2 mentions)
On targetplus non targeting sirna, by GE Healthcare (2 mentions)
Dulbecco modified eagle medium (dmem), by Merck Group (2 mentions)
H1229, by American Type Culture Collection (1 mentions)
Oe eif4a3, by Genechem (1 mentions)
Mir mimic, by RiboBio (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Si nc, by Genechem (1 mentions)
Mir inhibitor, by RiboBio (1 mentions)
P3000 reagent, by Thermo Fisher Scientific (1 mentions)
Mitohyper, by Evrogen (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
96 well plate luminometer, by Corning (1 mentions)
96 well plate, by Corning (1 mentions)
7 protocols using lipofectamine 3000 reagent
1
Isolation and Characterization of Mouse Keratinocytes and MEFs
2
Modulation of circSCAP and EIF4A3 in NSCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The normal human bronchial epithelial cell line (16HBE) and four NSCLC cell lines (SPCA1, A549, CALU3, and H1229) (ATCC, USA) were cultured under 5% CO2 at 37 °C in DMEM medium (Hyclone, USA) supplemented with 20% fetal bovine serum (FBS, Gibco, USA). For cell transfection, siRNAs against circSCAP (si-circSCAP, 5′‐GGCGGCTACCCACTGCTGAAA‐3′) and EIF4A3 (si-EIF4A3, 5′‐AAUCAUAUCAAAAACACGCCC‐3′), negative control (si-NC), and pcDNA3.1 ( +) circRNA vector for overexpressing EIF4A3 (OE-EIF4A3) and SMAD2 (OE-SMAD2) were custom synthesized by GeneChem Company (GeneChem, Shanghai, China). MiR-mimics, miR-7 mimics, miR-inhibitor, and miR-7 inhibitor were obtained from RiboBio Company (RiboBio, Guangzhou, China). When cell confluence reached about 70%, Lipofectamine 3000 reagent (Sigma Aldrich, USA) was applied to transfect cells according to the supplier’s procedures (Chen et al. 2021 (link)).
3
U2OS Cell Culture and Synchronization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U2OS cells (European Collection of Cell Cultures 92022711; Sigma-Aldrich) were maintained in DMEM (Sigma-Aldrich) supplemented with 10% (v/v) FCS (Lonza), 1% (v/v) penicillin/streptomycin, and 2 mM l -glutamine at 37 °C, 5% (v/v) CO2. For steady-state analysis of adhesion complexes in asynchronous cells, cells were cultured on glass coverslips for 48 h and then treated with indicated compounds for 1 h. U2OS cells were synchronized by using a double-thymidine block protocol. Cells were plated, and after 24 h of growth, thymidine was added to a final concentration of 2 mM, and the cells were incubated for 16 h. Cells were then washed twice with PBS and allowed to grow for 8 h in fresh DMEM. Thymidine was then added to a final concentration of 2 mM for an additional 16 h before cells were washed twice with PBS and released into DMEM. U2OS cells were transfected with DNA constructs by using Lipofectamine 3000 reagent (Sigma-Aldrich) and siRNAs by using oligofectamine (Sigma-Aldrich) according to the manufacturer’s instructions. Knockdown of CDK1 was performed by using SMARTpool reagents (L-003224-00-0005; GE Healthcare), and ON-TARGETplus nontargeting siRNA (GE Healthcare) was used as a negative control.
4
SLC25A10 Knockdown and Overexpression in AC16 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AC16 cells were transfected with siRNA targeting SLC25A10 (GenePharma, Shanghai, China) to downregulate SLC25A10 expression according to the manufacturer′s instructions. Lipofectamine 3000 reagent (Sigma-Aldrich, St. Louis, MO, USA) was used to transfect NC plasmid and SLC25A10 overexpression plasmid into AC16 cells. At 48 h post-transfection, the cells were subjected to H/R and then used for further examinations.
5
Transfection of NRVMs with MitoHyPer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NRVMs were plated on six-well plates at a density of 3 × 105 cells/well and transfected with Lipofectamine 3000 reagent (Sigma). For each transfection, 2.5 μg of MitoHyPer (Evrogen) was diluted in 125 μl of Opti-MEM medium (Thermo Fisher Scientific) in presence of 5 μl of P3000™ reagent (Life Technologies) and later combined with 4 μl of Lipofectamine™ 3000 (Life Technologies). The DNA-lipid complexes were added to the cells and incubated overnight. The day after, cells were rinsed with PBS and new MEM was added. Transfected cells were used for experiments after 48 h.
6
Sertoli Cell miR-100-3p Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 3,000 human Sertoli cells were seeded onto 96-well plates (Corning, United States). After 24 h of culture, Lipofectamine 3000 transfection agent (Sigma, United States) was employed to transfect miR-100-3p mimics or the mimics control to these cells. Forty-eight hours later, human Sertoli cells were transfected with 500 ng plasmids containing the binding sequence in 3′ untranslated regions (UTRs) of SGK3, firefly luciferase (reporter), or the renilla luciferase (internal control) (Genecreate, China) using the Lipofectamine 3000 reagent (Sigma, United States). Forty-eight hours after transfection, human Sertoli cells were lysed, and luciferase activity was determined using the 96-well plate luminometer (Corning, United States). The results were normalized to cells transfected with miRNA mimics control.
7
Synchronizing U2OS Cells for Adhesion Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U2OS cells (European Collection of Cell Cultures 92022711; Sigma-Aldrich) were maintained in DMEM (Sigma-Aldrich) supplemented with 10% (v/v) FCS (Lonza), 1% (v/v) penicillin/streptomycin, and 2 mM l-glutamine at 37°C, 5% (v/v) CO2. For steady-state analysis of adhesion complexes in asynchronous cells, cells were cultured on glass coverslips for 48 h and then treated with indicated compounds for 1 h. U2OS cells were synchronized by using a double-thymidine block protocol. Cells were plated and after 24 h of growth, thymidine was added to a final concentration of 2 mM, and the cells were incubated for 16 h. Cells were then washed twice with PBS and allowed to grow for 8 h in fresh DMEM. Thymidine was then added to a final concentration of 2 mM for an additional 16 h before cells were washed twice with PBS and released into DMEM. U2OS cells were transfected with DNA constructs by using Lipofectamine 3000 reagent (Sigma-Aldrich) and siRNAs by using oligofectamine (Sigma-Aldrich) according to the manufacturer's instructions. Knockdowns of CDK1 was performed by using SMARTpool reagents (L-003224-00-0005; GE Healthcare) and ON-TARGETplus nontargeting siRNA (GE Healthcare) was used as a negative control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!