Log In Sign up
The largest database of trusted experimental protocols

P5 adapter

Manufactured by Illumina
Visit Supplier

P5 adapters are a type of oligonucleotide used in Next-Generation Sequencing (NGS) library preparation. They are designed to be ligated to one end of DNA fragments, enabling their subsequent amplification and sequencing.

Automatically generated - may contain errors

Lab products found in correlation

Qubit fluorometer, by Thermo Fisher Scientific (2 mentions) Miseq personal sequencer, by Illumina (2 mentions) Sequencing platform, by Illumina (1 mentions) P7 adapter, by Illumina (1 mentions) Quickextract dna extraction solution, by Illumina (1 mentions) Miseq reagent kit v2 300, by Illumina (1 mentions) Qubit dsdna hs assay kit, by Thermo Fisher Scientific (1 mentions) Ampure xp, by Illumina (1 mentions)

Spelling variants of this product

Illumina adapters (41 citations) P5/P7 adapters (3 citations)

6 protocols using p5 adapter

1

Illumina Paired-End Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The paired-end sequencing mode of the Illumina sequencing platform was used for high-throughput sequencing of the DNA library. The constructed library structures from left to right (5′–3′) were (Figure 1(d)) as follows: Illumina P5 adapter, P5 sequencing primer (black Read 1), 16 bp barcode, 12 bp UMI, ploy(dT) VN sequence, inserted cDNA fragment, P7 sequencing primer (black Read 2), sample index (i7 index read), and Illumina P7 adapter. The available sequence length of Read 1 was 28 bp (16 bp barcode + 12 bp UMI), which was used to distinguish between cells and each different transcript (mRNA) of each cell, and Read 2, with a 91 bp sequence length, was used for comparison to the reference genome to determine genetic information.
Li Z., Yin L., Li Y., Cao Y, & Zeng H. (2022). Single-Cell RNA-Sequencing Reveals the Cellular and Genetic Heterogeneity of Skin Scar to Verify the Therapeutic Effects and Mechanism of Action of Dispel-Scar Ointment in Hypertrophic Scar Inhibition. Evidence-based Complementary and Alternative Medicine : eCAM, 2022, 7331164.
+ Open protocol
+ Expand
2

NGS Adapter Sequence Appending

Check if the same lab product or an alternative is used in the 5 most similar protocols
To perform NGS, adapter sequences were first appended to the sequences contained in each pool. Overhang adapter sequences for the forward and reverse primers were synthesized at IDT. The Illumina P5 adapter was added to the 5′ end of FP (P5FP) and a hexamer index and P7 adapter was added to the 5′ end of the RP (P7RP). Both positive and negative populations from each NGAL concentration were indexed by performing PCR with respective mixtures of P5FP (1 µM), P7RP (1 µM), dsDNA template (0.1 nM) and 1× KOD Hot Start master mix. PCR products of the correct size were purified via agarose gel extraction using QIAquick Gel Extraction Kit. Each sample was quantified via Bioanalyzer and mixed at equimolar ratio for sequencing on the NextSeq platform. The number of reads for each sequencing pool can be found in Supplementary Table ST9.
Bashir A., Yang Q., Wang J., Hoyer S., Chou W., McLean C., Davis G., Gong Q., Armstrong Z., Jang J., Kang H., Pawlosky A., Scott A., Dahl G.E., Berndl M., Dimon M, & Ferguson B.S. (2021). Machine learning guided aptamer refinement and discovery. Nature Communications, 12, 2366.
+ Open protocol
+ Expand
3

High-Throughput CRISPR Editing Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
To start, 2×105 U2OS.eGFP.PEST cells were nucleofected with either 20 pmol of SpCas9 or 20 pmol of preformed SpCas9:gRNA ribonucleoprotein complex. Approximately, 1×106 cells per well in a 12-well format were plated in the absence or presence of the compound at the indicated concentrations in two biological replicates. Cells were harvested at 10, 12, 14, and 18 h, and genomic DNA was extracted using the QuickExtract™ DNA extraction solution (Epicentre) by incubating the cells at 65°C for 15 min, 68°C for 15 min, and 98°C for 10 min. Next-generati on sequencing samples were prepared in a two-step PCR (Supplementary Table S1) following a reported protocol. In the first step, the PCR was performed using primers that amplified the target eGFP genomic loci of interest and also introduced an adapter priming sequence for the second-step PCR. The second-step PCR attached Illumina P5 adapters with barcodes, after which the PCR products were isolated via a two-step gel-purification protocol. DNA concentrations were determined using the Qubit® dsDNA HS Assay Kit (Life Technologies), and sequencing of the pooled samples was performed using a single-end read from 280 bases using the MiSeq Reagent Kit v2 300 (Illumina) according to the manufacturer’s protocol. The percentage of indel frequencies was calculated by analyzing the demultiplexed sequence files using MATLAB.
Maji B., Gangopadhyay S.A., Lee M., Shi M., Wu P., Heler R., Mok B., Lim D., Siriwardena S.U., Paul B., Dančík V., Vetere A., Mesleh M.F., Marraffini L.A., Liu D.R., Clemons P.A., Wagner B.K, & Choudhary A. (2019). A high-throughput platform to identify small-molecule inhibitors of CRISPR-Cas9. Cell, 177(4), 1067-1079.e19.
+ Open protocol
+ Expand
4

Targeted CRISPR Off-Target Analysis

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The top 12 predicted off-target sites were searched using The CRISPR Design Tool43 (link). The on-target and potential off-target regions were amplified using PrimeSTAR GXL DNA polymerase from the liver DNA via IV injection and used for library construction. Equal amounts of the genomic DNA was used to amplify genomic regions flanking the on-target and top 12 predicted off-target nuclease binding sites for library construction. Next, PCR amplicons from previous step were purified using Agencourt AMPure XP, then subject to second round PCR to attach Illumina P5 adapters and sample-specific barcodes. The purified PCR products were pooled at equal ratio for single-end sequencing using Illumina MiSeq at the Zhang laboratory (UCSD). The raw reads were mapped to mouse reference genome mm9 or custom built Ai14 mouse genome using BWA44 (link). High quality reads (score >30) were analysed for indel events and Maximum Likelihood Estimate (MLE) calculation as previously described43 (link). As next generation sequencing analysis of indels cannot detect large size deletion and insertion events, CRISPR/Cas9 targeting efficiency and activity shown above is underestimated.
Suzuki K., Tsunekawa Y., Hernandez-Benitez R., Wu J., Zhu J., Kim E.J., Hatanaka F., Yamamoto M., Araoka T., Li Z., Kurita M., Hishida T., Li M., Aizawa E., Guo S., Chen S., Goebl A., Soligalla R.D., Qu J., Jiang T., Fu X., Jafari M., Esteban C.R., Berggren W.T., Lajara J., Nuñez-Delicado E., Guillen P., Campistol J.M., Matsuzaki F., Liu G.H., Magistretti P., Zhang K., Callaway E.M., Zhang K, & Belmonte J.C. (2016). In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149.
+ Open protocol
+ Expand
5

VEGFR2 Gene Editing Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols
The genomic region containing the cutting site in mouse VEGFR2 gene was amplified by PCR using Q5 High-Fidelity 2X Master Mix, forward primer: TCTACAGTCCGACGATCATGAAAGAACACCCAAGGGAGG, and reverse primer: GACGTGTGCTCTTCCGATCGGGACGGAGAAGGAGTCTGT with the following PCR condition: 98°C for 30 s, 34 × (98°C for 10 s, 63°C for 30 s, 72°C for 10 s), 72°C for 2 min, hold at 4°C. The second round of PCR was used to attach the Illumina P5 adapters and sample-specific barcodes to the target amplicons. PCR products were pooled and purified through gel extraction (QIAquick Gel Extraction Kit). The concentrations of purified DNA samples were determined using Qubit Fluorometer (Thermo Fisher). Sequencing libraries were sequenced with the Illumina MiSeq Personal Sequencer. The indels were analyzed using the custom script available at https://github.com/piyuranjan/NucleaseIndelActivityScript.
Zhu H., Zhang L., Tong S., Lee C., Deshmukh H, & Bao G. (2018). Spatial control of in vivo CRISPR–Cas9 genome editing via nanomagnets. Nature biomedical engineering, 3(2), 126-136.
+ Open protocol
+ Expand
6

VEGFR2 Gene Editing Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols
The genomic region containing the cutting site in mouse VEGFR2 gene was amplified by PCR using Q5 High-Fidelity 2X Master Mix, forward primer: TCTACAGTCCGACGATCATGAAAGAACACCCAAGGGAGG, and reverse primer: GACGTGTGCTCTTCCGATCGGGACGGAGAAGGAGTCTGT with the following PCR condition: 98°C for 30 s, 34 × (98°C for 10 s, 63°C for 30 s, 72°C for 10 s), 72°C for 2 min, hold at 4°C. The second round of PCR was used to attach the Illumina P5 adapters and sample-specific barcodes to the target amplicons. PCR products were pooled and purified through gel extraction (QIAquick Gel Extraction Kit). The concentrations of purified DNA samples were determined using Qubit Fluorometer (Thermo Fisher). Sequencing libraries were sequenced with the Illumina MiSeq Personal Sequencer. The indels were analyzed using the custom script available at https://github.com/piyuranjan/NucleaseIndelActivityScript.
Zhu H., Zhang L., Tong S., Lee C., Deshmukh H, & Bao G. (2018). Spatial control of in vivo CRISPR–Cas9 genome editing via nanomagnets. Nature biomedical engineering, 3(2), 126-136.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!