Amplitaq gold 360 polymerase

Using the cell pellets from the harvest timepoints of T0 and/or T24 and/or T48, PCRs were performed using primers designed from 16S rRNA gene and sequenced to confirm the identity of the species (Additional file 1: Fig. S1). Strain-specific PCRs were performed with primers designed to differentiate between Lbr-6108, Lbr-35 and ATCC 14869, with Lbr-6108 to yield a 130 base pair (bp) amplification product using the primers Lbr-6108_Hyp_F (5′-GAACTTCATCAGTAGTGCGTTA-3′) and Lbr-6108_Hyp_R (5′-TGTTGGTCTTCGATATAGGTTAG-3′), while Lbr-35 and ATCC 14869 to yield a PCR product of 267 bp with the same primer set. Another Lbr-6108 strain identifying primer set, EP_F (5′-ACGTCTGGTTATAGCTCATCA-3′) and EP_R (5′-TAGTTTATCGACCGAGCCTT-3′) was designed to yield a 213 bp amplification product from Lbr-6108, and a 339 bp product from Lbr-35 and ATCC 14869. The PCRs were performed according to manufacturer’s specification of AmpliTaq Gold 360 polymerase (p/n 4398881, Thermo Fisher) and visualized using 2% ethidium bromide E-gels (p/n G501802, Thermo Fisher).

DNA from rat tissues was isolated using Invisorb Spin Tissue Mini Kit (Stratec Biomedical Systems, Birkenfeld, Germany). PCR was run with AmpliTaq Gold 360 polymerase (Thermo Fisher Scientific, Waltham, MA 02451, USA), 0.2 mM dNTPs (Merck KGaA, Darmstadt, Germany), and 0.5 μM of the following primers (Generi Biotech s.r.o., Hradec Králové, Czech Republic): TMEM70 ZFN-F CAGCATGTTGTTGCCTATGG, TMEM70 ZFN-R AGACCACACAATCTGGGACC. PCR products were resolved by 1.5% agarose gel electrophoresis. The presence of the Tmem70 transgene was evaluated by qPCR using primers, allowing amplification specifically from vector Tmem70 cDNA containing no introns. Primers were placed in exon 1 (F- GGCAGGCTGATTTATACTGGGA) and exon 2 (R- AAGGCTGACCACACTTGTAGA). The albumin gene was used as a control (F- AAGACGGCCATGTTTCTCTG, R- TGGAAGGTGAAGGTCTCAGC). Amplification was carried out with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA 02451, USA) at standard reaction conditions on the Viia7 instrument (Thermo Fisher Scientific, Waltham, MA 02451, USA). All reactions were conducted in triplicate. The allelic content of the Tmem70 transgene was calculated by the 2^−ΔΔCt relative quantification method using Quant Studio software (Thermo Fisher Scientific, Waltham, MA 02451, USA).