IFN-β treated HeLa S3 nuclear extract, was pre-incubated for 15 min on ice with 150 fmol linearized template (SpeI/PvuII fragments of basic pGL4[luc2.10], pGL4_OAS1Δ1 or pGL4_mtdupGGAA), in a 20 μl reaction containing, 0.5× binding buffer, 7.5 mM MgCl2, and 20 U RNAse inhibitor (Toyobo). The reaction was initiated by addition of 0.8 μl of 10 mM rNTP mix containing DIG-11-UTP (Roche Applied Science) to a final concentration of 0.4 mM ATP, 0.4 mM GTP, 0.4 mM CTP, and 0.26 mM DIG-11-UTP. Then incubated at 30 °C for 60 min, stopped with 180 μl stop buffer (10 mM EDTA, 0.2% SDS, 0.3 M sodium acetate, 50 μg/ml yeast tRNA) and RNA-bound proteins digested with 10 μg of proteinase K for 15 min at 55 °C. De novo RNA transcripts were purified by extraction with TE-saturated phenol and then phenol/chloroform, followed by ethanol precipitation. Then, separated by 8 M Urea denaturing PAGE, electrophoretically transferred to a nylon membrane in TBE and cross-linked to the membrane by UV-irradiation. DIG-labeled RNAs were detected with DIG-detection reagents (Roche Applied Science).
Dig 11 utp
Manufactured by Roche
Sourced in Switzerland
The DIG-11-UTP is a laboratory equipment product. It is designed for nucleic acid detection and labeling applications. The core function of this product is to provide a stable and efficient means of incorporating digoxigenin-labeled uridine triphosphate (DIG-11-UTP) into nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Pcrii topo vector, by Thermo Fisher Scientific (4 mentions)
Dnase 1, by Promega (3 mentions)
T7 or sp6 rna polymerase, by New England Biolabs (2 mentions)
Fitc 11 utp, by Roche (2 mentions)
Maxiscript t7 kit, by Thermo Fisher Scientific (2 mentions)
Anti dig ap antibody, by Roche (2 mentions)
Alphaphot 2 ys2, by Nikon (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Maxiscript kit, by Thermo Fisher Scientific (1 mentions)
Pcr 2.1 topo vectors, by Thermo Fisher Scientific (1 mentions)
Fluorescein 12 utp, by Roche (1 mentions)
Cy5 tyramide, by PerkinElmer (1 mentions)
Fluorescein tyramide, by PerkinElmer (1 mentions)
Thermoscript, by Thermo Fisher Scientific (1 mentions)
Dig detection reagents, by Roche (1 mentions)
Rnase inhibitor, by Toyobo (1 mentions)
Bio dot sf, by Bio-Rad (1 mentions)
Tsa kit, by PerkinElmer (1 mentions)
Bx63 fluorescence microscope, by Olympus (1 mentions)
Dna clean concentrator 5 column, by Zymo Research (1 mentions)
23 protocols using dig 11 utp
1
In Vitro Transcription Assay
2
Synthesis of armc10 antisense RNA probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNAs of the 3′untranslated region (3′UTR) of zebrafish armc10 was used to amplify templates for the synthesis of armc10 antisense RNA probes using the following primer pair: F2-armc10-utr 5′-CTCTGCTGGGGATTGTGG-3′ and R2-armc10-utr 5′-GAGAGTCCGGTCTCCTCCTC-3′. The sequence was then cloned into the pGEM-T Easy vector with T7 and SP6 RNA polymerase promoter sequences for in vitro transcription.
The templates used for synthesizing armc10 antisense RNA probes were generated by PCR amplification using pGEMT-armc10 as templates. RNA probes were generated by in vitro transcription from the T7 RNA promoter, incorporating DIG-11-UTP (Roche Diagnostics, Indianapolis, IN, USA) nucleotides, using Sp6 RNA polymerase with the MAXIscript kit (Ambion; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The DNA template was removed from the synthesized probe by DNaseI treatment and the probe was purified using LiCl-based precipitation. The probe was dissolved in DEPC-treated water and stored at −80°C.
The templates used for synthesizing armc10 antisense RNA probes were generated by PCR amplification using pGEMT-armc10 as templates. RNA probes were generated by in vitro transcription from the T7 RNA promoter, incorporating DIG-11-UTP (Roche Diagnostics, Indianapolis, IN, USA) nucleotides, using Sp6 RNA polymerase with the MAXIscript kit (Ambion; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The DNA template was removed from the synthesized probe by DNaseI treatment and the probe was purified using LiCl-based precipitation. The probe was dissolved in DEPC-treated water and stored at −80°C.
3
Viroid Transcript Cloning and Probe Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viroid transcripts of 302 ~ 372 nt containing positive monomeric full-length sequences of CEVd or HSVd were cloned into pcr2.1-TOPO vectors (Invitrogen, Life technologies, Carlsbad, CA, USA) as templates to allow generation of complimentary-strand probes (CEVd-p; HSV-p). In vitro transcription with T7 polymerase and DIG-modified UTP (DIG-11-UTP) was performed following the manufacturer’s protocol (Roche, Basel, Switzerland). The transcripts (20 μL) were diluted with nuclease-free water and then purified by centrifugation with phenol/chloroform. The purified transcripts were precipitated by addition of 1/10 volume of 3 M sodium citrate (pH5.2), 1/100 volume of glycogen and 3 volume of 100 % ethanol followed by centrifugation at 17,000 g for 15 min. The pellets were resuspended in 5 μL of nuclease-free water. Normally 1 μg of viroid-contained plasmid could generate approximately 3–5 μg of DIG-labeled RNA probe in our study. DIG-labeled probes were stored at −80 °C.
4
RNA Extraction and Transcript Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIZOL (ThermoFisher) from a single brain hemisphere of a mixed C57BL/6 background adult mouse. 5 μg total RNA was annealed to random hexamer primers and reverse transcribed with Thermoscript (ThermoFisher) according to the manufacturer’s protocol. KCTD2, KCTD5, and KCTD17 transcripts were amplified using primer pairs oNS286 and oNS287, oNS288 and oNS289, and oNS290 and oNS291, respectively.
For in situ hybridization, DNA templates bearing a terminal SP6 promoter for in vitro transcription were generated by PCR amplification of C57BL/6 mouse genomic DNA, using primer pairs oNS1204 and oNS1205 for KCTD2, oNS1207 and oNS1208 for KCTD5, and oNS1213 and oNS1214 for KCTD17. Riboprobes were transcribed with SP6 polymerase and DIG-11-UTP or Fluorescein-12-UTP (Roche). In situ hybridization was performed as described [70 (link)], amplifying Fluorescein- and DIG-labeled probes with Fluorescein-tyramide and Cy5-tyramide (Perkin Elmer) respectively.
For in situ hybridization, DNA templates bearing a terminal SP6 promoter for in vitro transcription were generated by PCR amplification of C57BL/6 mouse genomic DNA, using primer pairs oNS1204 and oNS1205 for KCTD2, oNS1207 and oNS1208 for KCTD5, and oNS1213 and oNS1214 for KCTD17. Riboprobes were transcribed with SP6 polymerase and DIG-11-UTP or Fluorescein-12-UTP (Roche). In situ hybridization was performed as described [70 (link)], amplifying Fluorescein- and DIG-labeled probes with Fluorescein-tyramide and Cy5-tyramide (Perkin Elmer) respectively.
5
Designing and Validating ISH Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ISH probes were designed to span 500–1000 base pairs and were targeted to CDS and/or UTR regions of each mRNA (see Table S2 ). Probes were designed to minimize cross-hybridization with off-target mRNAs, which was assessed using BLAST. For the detection of specific ORs, probes targeting multiple gene regions were typically generated and tested. Probe sequences were amplified by PCR using specific primers (Table S2 ), inserted into the pCRII-TOPO vector (ThermoFisher), and confirmed by restriction analysis and sequencing. DIG- and FITC-labeled antisense RNA probes were generated from 1 μg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) or FITC-11-UTP (Roche), treated with DNaseI (Promega), ethanol precipitated, and dissolved in a 30 μL volume of water.
6
Synthesis of Labeled RNA Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA transcripts were generated using the T7 Riboprobe in vitro Transcription kit (Promega, Madison, WI). RNA transcripts were synthesized in a reaction mixture containing 2.5 mm (each) ATP, CTP, GTP, and UTP. DIG-labeled riboprobes were synthesized in 20-μl reaction volumes containing 1 mm NTP or 1 mm (each) ATP, CTP, and GTP, 0.65 mm UTP, 0.35 mm DIG-11-UTP (Roche Applied Science), 500 ng of linearized template, 20 units of RNase inhibitor, and 40 units of T7 polymerase and incubated at 37 °C for 2 to 3 h. All reaction mixtures were then treated with 1 μl of DNase I for 15 min at 37 °C. The transcripts were purified by phenol-chloroform extraction and ethanol precipitation in the presence of ammonium acetate and then dissolved in RNase-free, double-distilled H2O (ddH2O). The concentrations of RNA transcripts were determined by measuring absorption at A260 with a NanoDrop 1000 spectrophotometer (Thermo Electron, MA).
7
In situ hybridization of cdi gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovary dissection, fixation, proteinase K treatment, re-fixation and hybridization steps were performed as described (PMID: 29813067). Matrices for probe preparation were prepared by PCR using cdi_F ATGTCGGAAACACTGCCACT and cdi_R GATAATACGACTCACTATAGGCAACTAACGATCCGATGC primers of genomic DNA of the cdiA strain. Labeling of RNA probes with DIG-11-UTP (Roche, Switzerland) was made by MAXIscript T7 kit (Ambion, Austin, TX, USA). Anti-DIG-AP antibodies (Roche, Basel, Switzerland) were used in 1:2000 dilution. Images obtained by binocular microscope Nikon Alphaphot-2 YS2 (Tokyo, Japan).
8
Chloroplast Run-On Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The chloroplast run-on assays were carried out as described by Chi et al. [56 (link)]. Plant samples of wild type and pd1 mutant were prepared from two-week-old seedlings and labeled with DIG-11-UTP (11209256910, Roche, Rotkreuz, Switzerland) according to the manual from Roche Applied Science. DNA probes (300 ng) of rpoB, clpP, psbA and psbD were amplified by RT-PCR and blotted onto Hybond N+ nylon membranes by a slot blotting apparatus (Bio-DotSF, Bio-Rad, Hercules, CA, USA). Hybridization was carried out employing a hybridization oven (HL-2000 HybriLinkerTM, UVP) overnight in 6× SSC, 5× Denhardt’s solution, 0.5% SDS and 50 μg/mL yeast tRNA at 65 °C. Hybridization results were analyzed by the exposure and development of X-ray film.
9
mRNA in situ Hybridization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were fixed overnight in 4% PFA, and mRNA in situ hybridizations carried out as previously described.7 (link) Fluorescent in situ hybridizations were performed using the TSA kit (Perkin-Elmer).23 (link) Primers used to generate new mRNA in situ probe constructs and information on published probes are detailed in Supplementary material online , Methods. Riboprobes were transcribed from linearized template in the presence of DIG-11-UTP or Fluorescein-11-UTP (Roche).
10
PKHD1L1 Expression in Mouse Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A PKHD1L1 cDNA fragment (bp7617-8320, 5′-atctggcagtctttgtacagca-3′, 5′-acaaacttagcactccagcctc-3′) produced by RT-PCR was subcloned into a pCRII-TOPO vector (ThermoFisher Scientific #K4610-20). cRNA sense and antisense probes tagged with DIG-11-UTP (Roche #11175025910) were produced using SP6/T7 RNA polymerase. Head blocks of P2 mice were cut as frozen sections at 10 µm thickness. In situ hybridization was performed as previously described48 (link). Slides were mounted and imaged with an Olympus BX63 fluorescence microscope. The images were processed with ImageJ and Adobe Photoshop.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!