Genescan 500 rox size standard

Total genomic DNA was extracted from young immature leaves as described by [37 (link)]. Fifty-eight SSR (simple sequence repeat) markers, spread across the nineteen chromosomes of grapevine genome, were used to genotype the wild-type and the mutant (Additional file 2). Of this set, twenty SSR markers were previously described by [37 (link)], thirty-two SSR markers used by [23 (link)] and six SSR markers developed by [24 (link)].
PCR amplifications for multiplex panels were carried out in a final volume of 12.5 μl containing 10 ng of genomic DNA, 0.25 mM of each dNTP, 2 mM MgCl₂, 1.5 U Taq DNA Polymerase (AmpliTaq Gold™, Applied Biosystems, Foster City, CA). The amplification protocol was as follows: 7 min at 95°C; 30 cycles of 45 sec at 95°C, 1 min at 54°C, 30 sec at 72°C; and 1 hour at 72°C. Primers failing to amplify at 54°C were further tested in single panel at different annealing temperatures.
PCR products (0.5 μl) were mixed with 9.3 μl of formamide and 0.2 μl of the GeneScan™ 500 ROX® Size Standard (Applied Biosystems) and 0.5 μl of this mix was subjected to capillary electrophoresis on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems) to separate DNA fragments. GeneMapper v3.5 (Applied Biosystems) was employed for the allele size estimation.

A multiplex PCR protocol was applied for MSI analysis. Samples for PCR were set up using the 2× Qiagen Multiplex PCR Kit to amplify five mononucleotide markers which were fluorescently labeled: BAT25(c-kit), BAT26(MSH2), NR21(SLC7A8), NR24(ZNF-2) and MONO27(MAP4K3) [6 (link)]. One microlitre of the template DNA extracted from formalin fixed tissue using the EZ1 Robot (Qiagen) was added to 25 ul PCR reaction. The following PCR programme was used to amplify selected markers: (Heated lid at 110 °C) 95 °C for 10 min, then 34 cycles of 94 °C for 1 min, 58 °C for 1 min and 72 °C 1 min, followed by 72 °C for 10 min. Following amplification, 1 ul of the PCR products were added to 0.5 ul of GeneScan™ 500 ROX™ Size Standard (an internal lane size standard for the Applied Biosystems fluorescence-based DNA electrophoresis systems) and 8.5 ul of formamide. Following denaturation (95 °C for 2 min and snap cooled on ice), the products were run on the 3130 genetic analyser (Applied Biosystems) and data processed using Genemarker software. Data supporting the conclusion of this article are included within the article.

We carried out PCR with genomic DNA from the giant panda “Panpan” to evaluate the sensitivity and specificity of the primers, as well as the optimum annealing temperatures. The microsatellite primers used in this study are listed in Table 2. The details of the PCR process are as follows: 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, 30 s at the annealing temperature, 72 °C for 30 s, and 72 °C for 10 min in the final extension step. Each PCR reaction mixture contained 5 μL 2× Taq master Mix (Shanghai Generay Biotech, Shanghai, China), 0.4 μL of each primer (10 μM), and 0.5 μg of genomic DNA in a total volume of 10 μL. PCR products were visualized on a 1% agarose gel.
Subsequently, 21 pairs of primers with high sensitivity and specificity were used for microsatellite polymorphism analysis. The fluorescence-labelled forward primers (tetrachloro-6-car-boxyfluorescein (TET), 6-carboxyfluorescein (FAM), and hexachloro-6-car-boxyfluorescein (HEX) dyes) were synthesized and used for the PCR with genomic DNA from 20 giant pandas. PCR products were diluted 1:10 and run using the 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA) with the GeneScan 500 ROX Size standard (Applied Biosystems). The output data were analyzed using Gene Mapper 4.1 (Applied Biosystems) to assign the genotype to each sample at each locus.

Epstein-Barr virus (EBV)-immortalized human lymphoblastoid cell lines (LCLs) were established and cultured as described [14] (link). Four BRCA1 mutant and six wild-type LCLs were grown in the absence and in the presence of cycloheximide (CHX) (100 µg/ml) for 4 hours to account for potential degradation of unstable transcripts via nonsense mediated mRNA decay. Total RNA was purified and reverse transcribed into cDNA as described [14] (link). The PCR reaction was performed with a forward primer in BRCA1 exon 5 (5′-GCATGCTGAAACTTCTCAAC-3′), and a reverse primer in exon 6 (5′-TCCAAACCTGTGTCAAGCTG-3′). The reverse primer was labeled with 6-carboxyfluorescein (6-FAM). The fluorescent amplification products were run on a 3130 Genetic Analyzer (Applied Biosystems) using the GeneScan 500 ROX Size Standard (Applied Biosystems) as internal marker. Size calling and quantification of peak areas were performed with GeneMapper Software v4.0 (Applied Biosystems). The molecular nature of the peaks was confirmed by sequencing.

DNA of tumour and corresponding non-tumour adjacent tissues showing promoter methylation in one of the tested MMR genes were investigated for MSI. For that purpose, we analysed two commonly used mononucleotide marker loci, BAT25 and BAT26.
PCR amplification was performed with following primers: BAT25_f (6FAM) TCGCCTCCAAGAATGTAAGT, BAT25_r TCTGCATTTTAACTATGGCTC, BAT26_f (NED)TGACTACTTTTGACTTCAGCC and BAT26_r AACCATTCAACATTTTTAACCC. The PCR reaction contained 1 µM forward and reverse primers, 0.25 µM dNTPs (each), buffer D (Invitrogen) for BAT25 or buffer E (Invitrogen) for BAT26, 0.25 µl AmpliTaqGold Polymerase (Roche). The PCR consisted of an activation of 8 min at 95°C, 45 cycles: 95°C 30 s, 55°C 15 s, 72°C 60 s and ending with an elongation at 72°C for 10 min. The PCR products were controlled by agarose gel electrophoresis and purified with QIAquick PCR Purification Kit (Qiagen, Germany) according to the manufacturer's protocol. 1.5 µl PCR product, 0.5 µl ROX-Standard (Gene Scan 500 ROX Size Standard, Applied Biosystems) and 8.5 µl HIDI formamide (Applied Biosystems) were analysed with GeneMapper and PeakScanner software of the 3130xl Genetic Analyzer (Applied Biosystems).
Finally, experiments were repeated several times to ensure reliability of MSI results.

The method used for MLVA typing, which included five loci (i.e., Mpn1, Mpn13, Mpn14, Mpn15, and Mpn16), was performed as described previously by Degrange et al., with slight modifications (31 (link)). The amplifications were performed in two mixes: mix 1 contained 1× PCR buffer (Qiagen), 200 nM concentrations of each dNTP, 1 mM MgCl₂; 0.5 μM concentrations (each) of primers Mpn1-F and Mpn1-R, 0.6 μM concentrations (each) of Mpn14-F, Mpn14-R, Mpn16-F, and Mp16-R, and 2.5 U of HotStarTaq enzyme (Qiagen). Mix 2 contained 1× PCR buffer, 200 nM concentrations of each dNTP, 1.5 mM MgCl₂, 0.6 μM concentrations of each primer Mpn13-F, Mpn13-R, Mpn15-F, and Mpn15-R, and 2.5 U of HotStarTaq enzyme. The primers were obtained from Eurogentec (Liège, Belgium). The cycling conditions were as described with the exception that the number of cycles was extended to 40 (31 (link)).
The PCR products were mixed with GeneScan 500 Rox size standard (Applied Biosystems) and Hi-Di formamide (Applied Biosystems). Subsequent fragment size separation and a determination of the number of repeats at each locus were performed via capillary electrophoresis using an ABI3730XL DNA analyzer (Applied Biosystems). The fragment analysis was performed using PeakScanner 2 (Applied Biosystems) software, following the guidelines proposed by Chalker et al. (32 (link)).