Vibrating blade microtome

Sixteen weeks after the recovery LD period brains were dissected from PER2::LUC knockin mice, mounted and cut into coronal slices (300 μm thick) on a vibrating blade microtome (Leica) in ice-cold HBSS supplemented with 100 U/ml penicillin/streptomycin, 10 mM HEPES, and 4.5 mM sodium bicarbonate. For each brain, the appropriate section containing the SCN was identified and the SCN area was dissected. SCNs were transferred to a Millicell cell culture membrane insert (PICM ORG 50, Millipore) with 1.2 mL of recording medium (DMEM (Invitrogen), supplemented with 10 mM HEPES (pH 7.2), 2% B27 (Invitrogen), 25 units/ml penicillin, 25 μg/ml streptomycin, and 0.1 mM luciferin). Individual tissue cultures were sealed in 35-mm Petri dishes with a coverslip using vacuum grease. Bioluminescence recordings from dissected SCNs were taken at 6 min intervals by a 32-channel/4-photomultiplier tube-containing LumiCycle (Actimetrics, IL, United States) apparatus, in a non-humidified, light-tight incubator maintained at 36°C. Data were analyzed on the LumiCycle Analysis software (Actimetrics, IL, United States). For the analysis, the first day of recordings were omitted as an “acclimatization day,” after which five consecutive cycles of bioluminescence were used for data analysis, to ascertain period and damping rate; only the first cycle was used to assess the acrophase of the rhythm.

To evaluate the impact of mutant LRRK2 on the interstitial solute drainage from the brain into dCLNs, LRRK2 transgenetic mice were intraparenchymally injected with FITC-dextran. 1 μL of 1% FITC-dextran in artificial CSF was stereotactically injected into the parenchyma at a rate of 0.1 μL/min over 10 min with a syringe pump from the bregma of the brain(coordinates: AP 1.5 mm; ML 1.5 mm and dorsal/ventral −2.5 mm). The needle was held at the site for 10 min after the infusion was complete to avoid backflow. At 2 h after injection, dCLNs and brains were removed and fixed in 4% paraformaldehyde. Then, brains were cut into 50 μm-thick coronal brain slices via a vibrating blade microtome (Leica), while dCLNs(30 μm-thick) were sectioned using a freezing microtome (Leica). Images were acquired with a Leica confocal microscope and analyzed by a blinded investigator to evaluate the differences of glymphatic clearance between the control and experimental groups.

Slice preparation and culture were performed as previously described (Loria et al, 2017). Briefly, hippocampal slices were prepared from 6‐day‐old mice. After decapitation, the brain was removed and immediately submerged in cold artificial cerebrospinal fluid (87 mM NaCl, 26 mM NaHCO₃, 50 mM sucrose, 10 mM glucose, 2.5 mM KCl, 1.25 mM NaH₂PO₄·H₂O, 0.5 mM CaCl₂, 3 mM MgCl₂·6H₂O), bubbled with carbogen (95% O₂, 5% CO₂). Coronal slices from the hippocampus (350 µm) were cut using a vibrating‐blade microtome (Leica). Slices were transferred into cell culture inserts of 0.4‐µm pore size (Merk Millipore), placed in six‐well culture dishes containing 1.2 ml of culture medium (50% minimum essential medium, 25% Hanks balanced salt solution [Gibco], 24% horse serum, 1% penicillin–streptomycin, supplemented with 36 mM D‐glucose [Sigma‐Aldrich] and 25 mM HEPES [Gibco]). Slices were incubated at 37°C in a humidified atmosphere containing 5% CO₂. The culture medium was replaced with fresh medium every 2 days. Cultures were maintained for 10 days in vitro prior to any experiment.

P6 C57BL/6J mice (both male and female pups) were sacrificed by cervical dislocation. Brains were removed, mounted, and cut into 300 μm coronal slices. Transverse slices of 300 μm were made on a vibrating blade microtome (Leica) in cold Hank’s Balanced Salt Solution supplemented with 100 U/ml penicillin/streptomycin, 10 mM HEPES, and 4.5 mM sodium bicarbonate. Each slice was transferred to a membrane insert (PICMORG50, Millipore Sigma) in a 35 mm culture dish with 1.2 ml of DMEM supplemented with 3.5 g/l D-glucose, 0.2 mM Glutamax, 10 mM HEPES, 25 U/ml penicillin/streptomycin, 50x B27 Plus, and 0.1 mM D-Luciferin sodium salt (Tocris). For knockdown of Serpina3n, slice cultures were transduced with AAV particles at the onset of culture. AAV particles harbored an shRNA sequence targeting Serpina3n (AACGGGTAGTGCCCTGTTTATT) or the original shRNA sequence targeting LacZ as a negative control (TGTCGGCTTACGGCGGTGATTT). Three days later, the slice cultures were stimulated for another three days with 10 ng/ml TNF prior to analysis. For Serpina3n dose-response assays, recombinant mouse Serpina3n (R&D Systems), at a concentration of 50 or 100 ng/ml, was added at the onset of culture and incubated for four days. For all experiments, slice chambers were sealed with a coverslip and maintained in a humidified incubator.