Frax597

HUVECs (PCS-100-013, ATCC) were grown in endothelial growth medium 2 (comprising endothelial basal medium 2 with growth factors and other supplements) with 2% fetal bovine serum. The cells were then incubated with neutrophils (control group), NETs (NETs group), NETs treated with 0.1 mg/ml DNase I (InvivoGen, San Diego, CA, USA), NETs and TLR9 antagonist (ODN 2088, San Diego, CA, USA), NETs and PAK2 inhibitor (FRAX597, Selleck Chemicals, Houston, TX, USA), and NETs and Hippo pathway inhibitor (XMU-MP-1, Selleck Chemicals, Houston, TX, USA) for 12 h at 37℃ under 5% CO₂. Then the cells were fixed with 10% polyformaldehyde for immunofluorescence analysis. Cell lysates were collected for Western blotting.

Endothelial cell tube formation assays were performed as previously described [42 (link)]. Briefly, 2F-2B and HUVEC (7 × 10⁴ cells/well) were re-suspended in DMEM + 5% FBS, and seeded onto growth factor-reduced BD matrigel (1 mg/ml) (96-well) for 1 h. Cells were then supplemented for 2 h with MDCK, MDCK^YBX1 or 21D1 Exos (30 μg), or the vehicle control (DMEM). For inhibitor based tube formation assays, 2F-2B and HUVEC cells (7 × 10⁴ cells/well) were pre-treated with Rac1 inhibitors: 1 μM FRAX597 (Selleck Chem) and 1 μM PF-3758309 (Selleck Chem) for 1 h. Cells were isolated (480 x g. 5 min) and re-suspended in DMEM + 5% FBS, and seeded onto growth factor-reduced BD matrigel (1 mg/ml) (96-well) for 1 h. Cells were then supplemented with MDCK, MDCK^YBX1 or 21D1 Exos (30 μg), or the vehicle control (DMEM). Tube-like structures were imaged using Nikon Eclipse TE300 microscope.

FAF‐overexpressing adenovirus vector (Adv‐FAF), adenovirus containing FAF siRNA (5'‐GCAGUUUCUCUUUCAUUCUTT‐3’) and corresponding control vectors with the enhanced green fluorescent protein (EGFP) were synthesized by GeneChem (Shanghai, China). The PAK2 inhibitor FRAX597 (C29H28ClN7OS; M.W. 558.10) was synthesized by Selleckchem (Houston, USA) and used at 5 µM for 12 hours. PAK2 expression plasmid and control vector were synthesized by GeneChem (Shanghai, China). miR‐185‐5p mimic (5'‐UGGAGAGAAAGGCAGUUCCUGA‐3’) and inhibitor (5'‐UCAGGAACUGCCUUUCUCUCCA‐3’) were acquired from RiboBio (Guangzhou, China) to alter miR‐185‐5p expression in vitro. NRCM were transfected with Adv‐FAF, si‐FAF, OE‐PAK2, miR‐185‐5p mimics and inhibitors, respectively, for 12 hours following the recommendations from the manufacturer.

The drugs employed in this study were as follows: dabrafenib (ApexBio, B1407‐50); XL888 (ApexBio, A4388‐25); fludarabine (Selleckchem, S1491); CHIR‐99021 HCl (CT99021) (Selleckchem, S2924); palbociclib (ApexBio, A8316); LDC000067 (ApexBio, B4754‐10); Ro 3306 (ApexBio, A8885‐10); roscovitine (ApexBio, A1723‐10); K03861 (Selleckchem, S8100); CHIR‐99021 (Selleckchem, S2924); dinaciclib (Selleckchem, S2768); FRAX597 (Selleckchem, S7271); PF‐3758309 (Selleckchem, S7094); AUY922 (Selleckchem, S1069); BIIB021 (Selleckchem, S1175); novobiocin (Selleckchem, S2492); 17‐DMAG (Selleckchem, S1142). All the drugs were dissolved in DMSO (Sigma D2650).

AZD4547, AZD5363, BGJ398, FRAX597 and IPA3 were purchased from Selleckchem, USA. For the MTS cell-viability assay, cell lines were seeded at appropriate density in 96-well plates for 24 h and then treated with either DMSO or inhibitor for 96 h in 5% CO₂ at 37 °C. Viability was measured by adding 20 µL per well of cell titer Aqueous One solution (Promega, Walldorf, Germany) for 2.5 h in 5% CO₂ at 37 °C. Absorbance was detected at 660 nm wavelength with a TECAN 200 M pro (TECAN, Zuerich, Switzerland). For counting of viable cells, cells were treated with either DMSO or inhibitor for the appropriate time, whereafter they were detached and counted by using a Guava Muse cell analyzer (Luminex, USA); counting was based on cell size and nucleation status.