3 aminophenylboronic acid

Manufactured by Merck Group

Sourced in United States

3-aminophenylboronic acid is a chemical compound used as a laboratory reagent. It is a colorless crystalline solid that is soluble in organic solvents. The compound contains a boronic acid functional group and an amine group, making it useful for various chemical reactions and applications in research and development.

Automatically generated - may contain errors

Lab products found in correlation

10 protocols using 3 aminophenylboronic acid

Silica-chitosan hybrid material synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

3-Mercaptopropyltrimethoxysilane (95%), tetraethyl
orthosilicate (98%), (3-glycidyloxypropyl)trimethoxysilane (98%),
chitosan (low molecular weight), 3-aminophenylboronic acid, (3-maleimido)propyl-functionalized
silica gel, ethanol (99%), fluorescein (free acid), triethylamine
(99.7%), xanthan gum, sodium benzoate (99%), sorbitol (99%), and glycerol
were obtained from Sigma-Aldrich (UK). (3-Acryloxypropyl)trimethoxysilane
(96%) was obtained from Gelest (Morrisville, USA). Ammonium solution
(S.G. 0.88, 35%) was obtained from Fisher Scientific. Aerosil R972
Pharma was obtained from Laurence Industries (UK).

Aspinall S.R, & Khutoryanskiy V.V. (2023). Surface Modification of Silica Particles with Adhesive Functional Groups or Their Coating with Chitosan to Improve the Retention of Toothpastes in the Mouth. Langmuir, 39(4), 1677-1685.

+ Open protocol

+ Expand

Electrochemical HbA1c Determination

Check if the same lab product or an alternative is used in the 5 most similar protocols

BSA, hydrogen peroxide (H₂O₂), ethanolamine, 3-aminophenylboronic acid (APBA), carbodiimide hydrochloride (EDC), N-hydroxy-succinimide (NHS) and 70% GA were purchased from Sigma-Aldrich (St. Louis, MO, USA). HbAo, HbA1c, anti-HbA1c were purchased from Fitzgerld Industries International (Acton, MA, USA). MWNTs (50 nm in diameter, 1–2 μm in length) were purchased from Shenzhen Nanotech Port Co. Ltd. (Shenzhen, China). Normal human sera were obtained from Renji Hospital, School of Medicine, and Shanghai JiaoTong University. The 16-channel screen-printed carbon electrode (16-SPCE) was purchased from Zhejiang Nanosmart Biotechnical Co. Ltd. (Ningbo, China).

Li Z., Li J., Dou Y., Wang L, & Song S. (2021). A Carbon-Based Antifouling Nano-Biosensing Interface for Label-Free POCT of HbA1c. Biosensors, 11(4), 118.

+ Open protocol

+ Expand

Glycan-Binding Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All solvents and reagents
were purchased from commercial sources and were used as received,
unless otherwise noted. Deionized water was used as a solvent in all
procedures. 3-Aminophenylboronic acid, Alizarin Red S (ARS), BSA, N-(3-(dimethylamino)propyl)-N-ethylcarbodiimide,
3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT),
and maleimide-functionalized silica beads and Sephadex G-25 were purchased
from Sigma-Aldrich (St. Louis, MO). Glucose, methyl β-O-glucopyranoside, ga lactose, methyl β-O-galactopyranoside, mannose, methyl α-O-mannopyranoside,
sialic acid, and lactose were purchased from Sigma-Aldrich (St. Louis,
MO). MAA-FITC and SNA-FITC were purchased from Bio-World (Dublin,
OH). 2-α-O-Methyl glycoside of Neu5Ac was synthesized
by a literature method.³³

Whited J., Rama C.K, & Sun X.L. (2018). Synthesis and Evaluation of Protein–Phenylboronic Acid Conjugates as Lectin Mimetics. ACS Omega, 3(10), 13467-13473.

+ Open protocol

+ Expand

Boronic Acid Disk Diffusion Assay for Cefoxitin Resistance

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Boronic acid (BA) solution was prepared by dissolving 12 mg of 3-Aminophenylboronic acid (Sigma-Aldrich, USA) in 3 ml of dimethyl sulfoxide and 3 ml of sterile distilled water was added to this solution (14 (link)). A total of 20 μl (400 μg) of the BA solution was dispensed onto disks containing cefoxitin (FOX). A test strain was inoculated on Mueller Hinton agar (MHA) plates according to the CLSI guideline. Disks containing cefoxitin (FOX) and cefoxitin plus BA (FOX/BA) were placed on the MHA plate and incubated at 37°C overnight. An increase in the zone size of ≥5 mm for cefoxitin in the presence of BA compared with that of cefoxitin alone was considered as positive result (20 (link), 21 (link)).

Faghihi K., Tajbakhsh S., Fouladvand M., Latifi B, & Yousefi F. (2023). Detection of plasmid-mediated AmpC β-lactamases in Klebsiella pneumoniae clinical isolates from Bushehr province, Iran. Iranian Journal of Microbiology, 15(3), 373-382.

+ Open protocol

+ Expand

Core-shell CdSe/ZnS QDs Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Core-shell CdSe/ZnS QDs with maximum emissions of approximately 520 nm and a lipophilic long chain surfactant capping of octadecylamine (ODA) were purchased from Mesolight (Suzhou, China). In general, all chemicals were used as received without further purification. 3-Mercaptopropionic acid (MPA) was purchased from Fluka. 3-Aminophenylboronic acid (APBA), 1-ethyl-3-(3-(dimethylamino) propyl)carbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS), phosphate buffer salts, Tris buffer, bovine serum albumin (BSA), and all other inorganic salts were of analytical grade and used as obtained from Sigma-Aldrich (Spain). NaOH (Sigma-Aldrich, Spain) and HCl (Sigma-Aldrich, Spain) (spectroscopic grade quality) were used to adjust the pH of the aqueous (Milli-Q water) solutions and buffers. In order to avoid deterioration by light and heat, stocks solutions were kept in the dark at 4 °C in a refrigerator.
For the cell culture, Dulbecco’s modified Eagle’s medium (DMEM), foetal bovine serum (FBS), sodium pyruvate, penicillin, and streptomycin were obtained from Sigma. GlutaMAX^TM supplement was acquired from ThermoFisher (Madrid, Spain). Cell viability assays were carried out using a CellTiter Blue™ viability assay (Promega Biotech Ibérica, Madrid, Spain). For microscopy experiments, all solutions were filtered with 0.2 μm filters (Whatman; as supplied by Sigma-Aldrich, Spain) before use.

Ripoll C., Orte A., Paniza L, & Ruedas-Rama M.J. (2019). A Quantum Dot-Based FLIM Glucose Nanosensor. Sensors (Basel, Switzerland), 19(22), 4992.

+ Open protocol

+ Expand

Detecting Deacylated tRNAs via APB Gels

Check if the same lab product or an alternative is used in the 5 most similar protocols

APB gels required 50 milligrams of 3-aminophenylboronic acid (Sigma) per 10 ml of the polyacrylamide mix (8% polyacrylamide and 8 M urea). The total RNA was isolated using the guanidine isothiocyanate protocol (23 (link)). Deacylated tRNAs were prepared by incubation of total RNA in 100 mM Tris (pH 9.0) for 30 min at 37°C. Oxidation controls were prepared by RNA incubation in 50 mM NaOAc (pH 4.5) and 2.5 mM NaIO₄ for 2 h at 37°C in the dark and quenched with 2 mM glucose for 30 min at 37°C in the dark. All RNA samples were ethanol precipitated and 10 μg of RNA was resuspended in RNA urea loading dye to load onto the APB polyacrylamide gel. The electrophoresis was carried out for 4 hours at 80 Volts. The northern hybridization was performed on zeta-probe membrane according to manufacturer's instructions (Bio-Rad). The blots were scanned using a Typhoon FLA 9000 scanner and the Q levels were quantified using an ImageQuant TL software (GE healthcare). The membranes were hybridized with the following probes:
tRNA^TyrGTGGTCCTTCCGGCCGGAATCGAA, tRNA^HisGGGAAGACCGGGAATCGAAC, tRNA^AspCGGGTCACCCGCGTGACAGG,
tRNA^AsnAACCAACGACCTGTAGGTTAACAGC

Dixit S., Kessler A.C., Henderson J., Pan X., Zhao R., D’Almeida G.S., Kulkarni S., Rubio M.A., Hegedűsová E., Ross R.L., Limbach P.A., Green B.D., Paris Z, & Alfonzo J.D. (2021). Dynamic queuosine changes in tRNA couple nutrient levels to codon choice in Trypanosoma brucei. Nucleic Acids Research, 49(22), 12986-12999.

+ Open protocol

+ Expand

Biofunctionalized Hydrogel for Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sodium alginate (W201502-1KG; Sigma-Aldrich, Milan, Italy), type A gelatin from porcine skin (G2500-100G; Sigma-Aldrich, Milan, Italy), tyramine, 3-aminophenylboronic acid, N-hydroxysuccinimide (NHS), MES buffer 0.1 M, phosphate-buffered saline (PBS), peroxidase from horseradish, lyophilized, powder ~150 U/mg (HRP enzyme; 77332-100MG; Sigma-Aldrich, Milan Italy), hydrogen peroxide solution, fetal bovine serum (F7524; Sigma-Aldrich, Italy), penicillin–streptomycin (P0781-100ML; Milan, Sigma-Aldrich, Italy), and McCoy’s 5A modified medium powder for cell culture were provided by Sigma-Aldrich (Milan, Italy). N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) was purchased from Tokyo Chemical Industry Co. (TCI, Zwijndrecht, Belgium). Live/Dead Cell Viability Assay kit for 3D and 2D cell culture was obtained from EMD Millipore Corp (Milan, Italy) and HT29 cells (human colorectal adenocarcinoma cell line) were purchased from LGC Standards S.r.L (Milan, Italy).

Cadamuro F., Ardenti V., Nicotra F, & Russo L. (2023). Alginate–Gelatin Self-Healing Hydrogel Produced via Static–Dynamic Crosslinking. Molecules, 28(6), 2851.

+ Open protocol

+ Expand

Meayamycin B Isolation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Meayamycin B was described previously [58 (link)]. Isoginkgetin was purchased from Millipore and resuspended in DMSO. 3-Aminophenylboronic acid was purchased from Sigma and resuspended in DMSO.

Schreiber C.A., Sakuma T., Izumiya Y., Holditch S.J., Hickey R.D., Bressin R.K., Basu U., Koide K., Asokan A, & Ikeda Y. (2015). An siRNA Screen Identifies the U2 snRNP Spliceosome as a Host Restriction Factor for Recombinant Adeno-associated Viruses. PLoS Pathogens, 11(8), e1005082.

+ Open protocol

+ Expand

Site-specific tRNA Q-base Incorporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

For incorporation of Q-base at position 34, unlabeled or fluorescein labelled sptRNA^Asp, was incubated with 100 fold molar excess of free Q base and under presence of 0.5 µM purified his-hTGT (100 mM HEPES pH 7.5, 20 mM MgCl₂, 5 mM DTT). After four hours the reaction was precipitated with ethanol and pelleted RNA was resolubilized in H₂O. Unreacted free Q-base was removed by desalting using Zeba spin desalting columns 7 K MWCO (ThermoFisher Scientific). Q-incorporation was confirmed by a Q-specific band-shift, a method previously described^{27 (link)}, using denaturing 10% polyacrylamide gels containing urea and 0.5% (w/v) 3-aminophenylboronic acid (Sigma Aldrich).

Johannsson S., Neumann P., Wulf A., Welp L.M., Gerber H.D., Krull M., Diederichsen U., Urlaub H, & Ficner R. (2018). Structural insights into the stimulation of S. pombe Dnmt2 catalytic efficiency by the tRNA nucleoside queuosine. Scientific Reports, 8, 8880.

+ Open protocol

+ Expand

Synthesis of Gold Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

All of the materials were purchased from Sigma-Aldrich: hydrogen tetrachloroaurate (III) hydrate, acrylic acid, tribasic sodium citrate, tetrahydrofuran, hydrochloric acid, azobisisobutyronitrile (12 wt. % in acetone), 3-aminophenyl boronic acid, and sodium hydroxide. All materials were used as purchased.

Wikantyasning E.R., Da’i M., Cholisoh Z, & Kalsum U. (2023). 3-Aminophenylboronic Acid Conjugation on Responsive Polymer and Gold Nanoparticles for Qualitative Bacterial Detection. Journal of Pharmacy & Bioallied Sciences, 15(2), 81-87.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!