Amc hn 8

The LSCC cell line AMC‐HN‐8 was purchased from BeNa Culture Collection (Shanghai, China). The cells were cultured in RPMI 1640 (HyClone, Logan, UT, USA) with 10% fetal bovine serum (PAN Biotech, Aidenbach, Germany) at 37°C and 5% CO₂. Cells were counted using a TC10 automatic cell counter (BioRad). The lentivirus vector was purchased from GenePharma (Shanghai, China). Stably transfected cells were selected through puromycin. The tRNA^Ini_CAT overexpression lentivirus vector is termed LV3‐tRNA^Ini_CAT, Sequences: 5′‐ AGCAGAGTGGCG CAGCGGAAGCGTGCTGGGCCCATAACCCAGAGGTCGATGGATCGAAACCATCCTCTGCTA‐3′, LV3‐NC used as a control, sequence: 5′‐ TTCTCCGAACGTGTCACGT‐3′.

The human laryngeal cancer cell lines (ie TU686, TU177, AMC‐HN‐8, and LSC‐1) (Bena culture collection) and the normal human bronchial epithelial cells (NHBEC) were routinely cultured in RPMI1640 medium (Gibco) that consisted of 10% fetal bovine serum (FBS, Hyclone) at 37°C. Placed within an incubator of 5% CO₂, the cells were digested with 0.25% membrane protease (Sigma) every 2‐3 days.

The paraffin-embedded specimens of 110 LSCC, 30 noncancerous tissues and 30 tissues of laryngeal severe dysplasia were kindly acquired from the Pathology Department in the Second Affiliated Hospital of Harbin Medical University. All 110 LSCC patients were diagnosed by professional pathologist, and were all initially treated by partial or total laryngectomy at the Otorhinolaryngology Department, the Second Affiliated Hospital of Harbin Medical University from February 2008 to October 2012. 74 LSCC patients among them, who underwent tumor recurrence after surgery, had received chemotherapy for further treatment. All 110 patients were followed up for at least 5 years. In addition, 30 paired LSCC and adjacent noncancerous tissues were kindly obtained from patients and were snap frozen in liquid nitrogen within 15 min after excision. All patients provided written informed consent in accordance with the Declaration of Helsinki. The study was approved by the Ethics Committee of The Second Affiliated Hospital of Harbin Medical University. The laryngeal carcinomas cell lines (AMC-HN8, TU212, TU686)^{32 (link)} were provided by BeNa Culture Collection (Jiangsu, China). Cells were cultured in DMEM medium (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (PAN-Biotech, Adenbach, Germany) and incubated in a humidified 37 °C incubator with 5% CO₂.