Stealth siRNA oligonucleotides were synthesized by Invitrogen. The following siRNA sequences were used for knockdown of LCAL1: siRNA 1 GGACAGGCTGCAGTCATCATATGGA and siRNA 2 GGCATGTGTTCAGACATATCCTAAA. Cells were transfected with 50 pmol of siRNA and a scrambled-matched %GC oligo as control with RNAimax Lipofecatmine (Invitrogen) following the manufacturer’s instructions. Knockdown efficiency was determined by qPCR at time of plating for assay. After 72 hours, cells were then plated at 200,000 cells/well for proliferation assays. Cells were counted using the Beckman Z1 Coulter Counter at days 2, 4, and 6. At least three biological replicates were performed for each siRNA construct over two experiments.
Stealth sirna oligonucleotides
Manufactured by Thermo Fisher Scientific
Sourced in United States
Stealth siRNA oligonucleotides are synthetic double-stranded RNA molecules designed to target and silence specific genes. They function by binding to and degrading the target mRNA, thereby preventing the production of the corresponding protein.
Automatically generated - may contain errors
Lab products found in correlation
Rnaimax, by Thermo Fisher Scientific (5 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Control oligonucleotides, by Thermo Fisher Scientific (1 mentions)
Nucleofector 96 well electroporation system, by Lonza (1 mentions)
Quikchange site directed mutagenesis system, by Agilent Technologies (1 mentions)
Tbb 4 5 6 7 tetrabromobenzotriazole, by Selleck Chemicals (1 mentions)
Casein kinase 2 ck2 p60105 recombinant protein, by New England Biolabs (1 mentions)
Adenosine 5 triphosphate atp p07565, by New England Biolabs (1 mentions)
10 protocols using stealth sirna oligonucleotides
1
siRNA-mediated LCAL1 Knockdown Assay
2
Targeting FAK in B16F10 Melanoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B16F10 cells were plated at 1.5 × 105 cells in six-well plates. Cells, 18 h later, were transfected with 50 pmol of siRNA for 5 μl lipofectamine 2000 in 500 μl Opti-MEM (Gibco, Grand Island, NY, USA). Stealth siRNA oligonucleotides (Invitrogen) used were control siRNA 5′-GAAUCUCAUCUAUUUCGUAACGGAC-3′ and FAK siRNA 5′-UGACAGAUACCUAGCAUCUAGCAAA-3′. These sequences have already been described to target the 5′-UTR region of FAK in rat MTLn3 cells,41 (link) however, a sequence alignment was performed using the link http://www.ba.itb.cnr.it/BIG/Blast/BlastUTR.html to check out sequence homology in Mus musculus as B16F10 cell line stems from murine lineage. Transfected cells were incubated for 48 h (unless otherwise indicated) at 37 °C before use.
3
HIF1α Knockdown in Hypoxia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded at 20–40% confluency and the day after transfected with 25 nM siRNA using Lipofectamine RNAiMAX according to the manufacturer’s protocol. One day later, cells were incubated under normoxia or hypoxia with fresh McCoy's 5A Medium containing 10% FBS and processed for designated assays. The following stealth siRNA oligonucleotides (Invitrogen) were used for human HIF1α knockdown: 5‘- GGGAUUAACUCAGUUUGAACUAACU-3′ (sense) and 5′- AGUUAGUUCAAACUGAGUUAAUCCC-3’. Control oligonucleotides with comparable GC content were also purchased from Invitrogen.
4
Modulation of Lymphoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human Burkitt's lymphoma line BL2, the mouse B-cell lymphoma line CH12F3-2A expressing Bcl2, and the TOP1-deficient P388/CPT45 cells expressing GFP (P388/CPT45-GFP) or GFP-tagged human TOP1 (P388/CPT45-GFP-TOP1) were previously described24 (link)29 (link)44 (link). The BL2 and P388/CPT45 cells also express AIDER, a fusion protein in which AID is fused to the hormone-binding domain of the estrogen receptor (ER), which is activated by treating cells with OHT. Chemically modified Stealth siRNA oligonucleotides (Invitrogen) were introduced into cells using the Nucleofector 96-well electroporation system (Lonza) to knockdown the expression of specific genes. After electroporation, the cells were cultured for 24 h, and then stimulated by CIT (CD40L, IL4 and TGFβ) or OHT (1 μM), and cultured for another 24–72 h before collection and analysis. The list of antibodies, primers and Stealth siRNAs used in this study is shown in Supplementary Tables 8–10 .
5
Transient Myosin VI and Optineurin Knockdown
6
Transient Knockdown of CLC Channels in Caco-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transient CLCa and/or CLCb KD were performed using Stealth siRNA oligonucleotides from ThermoFisher Scientific (humanCLCA-3utr target sequence: 5′-TGGAAACACTACATCTGCAATATCT-3′ and humanCLCB-3utr target sequence: 5′-CGCCTCCTCTCAGTCTACTCAATTG-3′) or Qiagen [humanCLCa (2) target sequence: AGACAGTTATGCAGCTATT].
Caco-2 (or HeLa, Supplementary Figs.1 and 11d ) cells were transfected using RNAiMax (Invitrogen) and siRNA oligos at 8 nM final concentration. Cells were transfected twice, first in suspension and the day after in adhesion. The third day Caco-2 cells reach confluency and were kept confluent for additional 7 days in order to obtain a compact polarized monolayer. Medium was changed every 2 days.
Caco-2 (or HeLa, Supplementary Figs.
7
Transient Myosin VI Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transient knock‐downs (KD) were performed using Stealth siRNA oligonucleotides from Thermo Fischer Scientific (Waltham, MA, USA). Cells were transfected twice using RNAiMax (Invitrogen), first in suspension and the following day in adhesion. Based on immunoblot analyses, cells were considered myosin VI‐depleted four days after the first transfection.
myosin VI #1 (when not specified, this siRNA is used to deplete myosin VI): 5′‐GAGGCUGCACUAGAUACUUUGCUAA‐3′. myosin VI #2: 5′‐GAGCCTTTGCCATGGTACTTAGGTA‐3′. OFD1: 5′‐GAGAAUGAAGUGUACUGCAAUCCAA‐3′. p53: 5′‐CCAGUGGUAAUCUACUGGGACGGAA‐3′.
hTERT‐RPE1 cells with doxycycline‐inducible shRNA for myosin VI were generated by transducing the cells with pSLIK‐NEO myosin VI shRNA and selection with neomycine. Expression of the shRNA was induced with 0.5 μg/ml doxycycline for 10 days.
myosin VI #1 (when not specified, this siRNA is used to deplete myosin VI): 5′‐GAGGCUGCACUAGAUACUUUGCUAA‐3′. myosin VI #2: 5′‐GAGCCTTTGCCATGGTACTTAGGTA‐3′. OFD1: 5′‐GAGAAUGAAGUGUACUGCAAUCCAA‐3′. p53: 5′‐CCAGUGGUAAUCUACUGGGACGGAA‐3′.
hTERT‐RPE1 cells with doxycycline‐inducible shRNA for myosin VI were generated by transducing the cells with pSLIK‐NEO myosin VI shRNA and selection with neomycine. Expression of the shRNA was induced with 0.5 μg/ml doxycycline for 10 days.
8
Transient Knockdown of Deubiquitinating Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transient knock-downs were performed using Stealth siRNA oligonucleotides from Thermo Fischer Scientific (Waltham, MA, USA). Cells were transfected twice by using RNAiMax (Invitrogen), first in suspension and the following day in adhesion. The following RNAis were used:
S1 CAGGAGGAGACAACUUACUACCAAA;
S1 CGCUCUGGAGUUGAGAUUAUCCGAA;
S1 UCGUGAUGAGGAAAGGGCCUAUGUA.
9
Transient Myosin VI and Optineurin Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transient myosin VI and optineurin knock-down were performed using Stealth siRNA oligonucleotides (ThermoFisher Scientific). Cells were transfected using RNAiMax (Invitrogen) at 8nM final concentration according to manufacturer’s instruction. For double knock-down single oligos were used at a final 4nM each. Two oligonucleotides (shown in Supplementary Table 2 ) were used with comparable results. HeLa stably knocked down for Myosin VI were generated using a pSUPER vector carrying the shRNA shown in Supplementary Table 2 , targeting a sequence in the motor domain.
10
Mutagenesis and siRNA Targeting of Che-1 and CK2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Myc-Che-1 has already been described [12 (link), 27 (link)]. pCI-HDAC 1 was a kind gift from Dr. Sartorelli, while pSG5 Large T (pSG5 SV40 LT) plasmid was a gift from William Hahn (Addgene plasmid #9053; http://n2t.net/addgene:9053 ; RRID: Addgene_9053). Myc-Che-1 3S and pSG5 SV40 LT 3S were generated by in vitro mutagenesis using the QuikChange site-directed Mutagenesis system (Agilent Technologies) following the manufacturer’s instructions. PCR reactions were achieved using the following primers:
Myc- Che-1 3S:
Stealth siRNA oligonucleotides targeting Che-1 (siChe-1), CSNK2A (siCK2), control sequence (siControl) and custom Che-1 3’UTR (sense 5′-CCCGCCUUUAAACGCCACAAAUAAA-3′; antisense 5′-UUUAUUUGUGGCGUUUAAAGGCGGG-3′) were purchased from Thermo Fisher Scientific. TBB (4,5,6,7 – Tetrabromobenzotriazole) was purchased from SelleckChem. Casein kinase II (CK2 - P60105) recombinant protein and Adenosine 5′-triphosphate (ATP - P07565) were purchased from New England BioLabs.
Myc- Che-1 3S:
Forward 5′ - GCCCAATGCGGGA
Reverse 5′ - GCTCATCATCTTCACCAGCAATCTCCTCACCTCCCGCATTGGGC - 3′
Forward 5′ - AACCTGTTTTGC
Reverse 5′ - AGCCTCATCATCACCAGCTGGCATTTCTTCTGCGCAAAACAGGTT - 3′
Stealth siRNA oligonucleotides targeting Che-1 (siChe-1), CSNK2A (siCK2), control sequence (siControl) and custom Che-1 3’UTR (sense 5′-CCCGCCUUUAAACGCCACAAAUAAA-3′; antisense 5′-UUUAUUUGUGGCGUUUAAAGGCGGG-3′) were purchased from Thermo Fisher Scientific. TBB (4,5,6,7 – Tetrabromobenzotriazole) was purchased from SelleckChem. Casein kinase II (CK2 - P60105) recombinant protein and Adenosine 5′-triphosphate (ATP - P07565) were purchased from New England BioLabs.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!