Formalin, ethanol, xylene, and isoamyl alcohol were purchased from the National Pharmaceutical Corporation (Shanghai, China). DNA/RNA extraction kits were purchased from Qiagen Inc. (Valencia, CA, USA). Primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The 5× All-In-One MasterMix was purchased from abm (Zhenjiang, China). Premix Ex Taq™ II was bought from Takara Bio Inc. (Shiga, Japan).
Dna rna extraction kit
Manufactured by Qiagen
Sourced in Germany, United States
The DNA/RNA extraction kit is a laboratory product designed for the isolation and purification of nucleic acids, including DNA and RNA, from a variety of biological samples. The kit provides the necessary reagents and protocols to efficiently extract and concentrate the target genetic material for downstream applications, such as analysis, amplification, or further processing.
Automatically generated - may contain errors
Lab products found in correlation
Fastprep 24, by MP Biomedicals (2 mentions)
Zirconia silica bead, by Biospec (2 mentions)
2100 bioanalyzer instrument, by Agilent Technologies (2 mentions)
Nanodrop 8000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Premix ex taq 2, by Takara Bio (1 mentions)
All in one mastermix, by Applied Biological Materials (1 mentions)
Abi 3130xl, by Thermo Fisher Scientific (1 mentions)
Platinum pcr supermix high fidelity, by Thermo Fisher Scientific (1 mentions)
Epitect bisulphite kit, by Qiagen (1 mentions)
Tri reagent solution, by Merck Group (1 mentions)
Icycler iq5, by Bio-Rad (1 mentions)
Qubit fluorometric quantitation, by Thermo Fisher Scientific (1 mentions)
Omni bead ruptor elite, by Omni International (1 mentions)
Rnalater, by Qiagen (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Cfx384 touch real time pcr detection system, by Bio-Rad (1 mentions)
10 protocols using dna rna extraction kit
1
Nucleic Acid Extraction and PCR Amplification
2
HBV Genotyping from Plasma Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 300 µl of plasma using commercial DNA/RNA extraction kits (Qiagen, USA). The presence of HBV-DNA was confirmed and quantified using a previously described method [14] (link). For the preliminary genotyping, samples with detectable viremia were subjected to a nested PCR using a high proof reading enzyme mixture (Platinum PCR Super Mix High Fidelity, LifeTech, USA), that yielded a 879 bp fragment. Sequencing was performed in an automated DNA sequencer (ABI 3130xl, LifeTech, USA) using primers previously described [13] (link).
The full-length genome of Panamanian sequences clustering in particular clades of genotype F, were amplified using two protocols previously published [15] (link), [16] (link). When a sample failed to yield a good quality product with the one-step protocol, the nested approach was used.
The sequences obtained in this study were deposited in Genbank under the accession numbers KJ638656-KJ638679.
The full-length genome of Panamanian sequences clustering in particular clades of genotype F, were amplified using two protocols previously published [15] (link), [16] (link). When a sample failed to yield a good quality product with the one-step protocol, the nested approach was used.
The sequences obtained in this study were deposited in Genbank under the accession numbers KJ638656-KJ638679.
3
Extracting DNA from Insect Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 108 sampled individuals were dissected to extract their DNA. Prior to dissection, all individuals were surface sterilized using sodium hypochlorite (1%). Tissues were then dissected out using sterilized instruments. All tissues were rinsed in Ringer solution to avoid cross-contamination between tissues. Caeca and hindguts (with their contents) from 3 males and 3 females were kept as separate samples, and the remaining tissues were discarded. Each pooled sample was frozen in liquid nitrogen and ground with a mortar and pestle. The resulting powders were processed using a DNA/RNA extraction kit (Qiagen, Courtaboeuf, France) to extract DNA according to the manufacturer’s protocol. The extracted DNA was stored at –20 °C until use.
4
Salmonella Quantification in Gut Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Entire SI and colonic contents were collected, placed in 1 mL lysis buffer and 200 mg 0.1mm diameter zirconia silica beads (BioSpec, Bartlesville, OK) and vortexed on a bead beater (FastPrep 24, MP Biomedicals). DNA isolation was performed using DNA/RNA Extraction kit (Qiagen, Valencia, CA). Quantification of Salmonella was performed by real-time PCR using primers specific to siiA (ACGACTGGGATATGAACGGGGAA and TCGTTGTACTTGATGCTGCGGAG)62 (link) and measured against a standard curve.
5
Gluten-specific CD4+ T Cell Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cryo-preserved PBMC samples were thawed by resuspension into complete RPMI, and re-stimulated, after a resting period of 60 min at 37°C, with a pool of 3 immunodominant gluten peptides (LQPFPQPELPYPQPQ “DQ2.5-glia-α1a & α2”, QPFPQPEQPFPWQP “DQ2.5-glia-ω1 & ω2” and PEQPIPEQPQPYPQQ “DQ2.5-hor-3”)5 (link),33 (link), each in a final concentration of 100 microgram/ml. After 16 h, cells were resuspended in PBS, and incubated with IFNg catch reagent, followed by staining with PE anti-IFNg detection antibody (IFNg secretion assay kit; Miltenyi Biotech) and FITC anti-CD4 antibody (clone OKT4; Biolegend), according to manufacturer’s instructions. IFNg secreting CD4+ T cells were separated by FACS sorting, using a BD Facs Aria II instrument. Cells were also stained for gut-homing marker CCR9 in 6 of the 8 samples, which showed that the selected CD4+ IFNg+ population was enriched with cells expressing CCR9 compared to CD4+ IFNg− cell fraction (84% vs 40%, Supplementary Figure S13 ). DNA was extracted from the sorted cell pellets using a DNA/RNA extraction kit (Qiagen).
6
Salmonella Quantification in Gut Microbiome
7
Ovarian RNA Extraction and Quality Assessment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNA/DNA extraction kit (Qiagen, Germany) following manufacturer’s instructions. For PND6 samples, two ovaries from two littermates were pooled for RNA extraction. For PND14 and PND22, only one ovary from one littermate was used for RNA extraction. RNA quantity was assessed using a NanoDrop™ 8000 Spectrophotometer (Thermo Fisher Scientific), and RNA quality using a 2100 Bioanalyzer Instrument (Agilent Technologies, CA, USA) according to manufacturer’s instructions. Only samples with an RNA integrity number (RIN)-score > 7 were included for sequencing.
8
Quantifying DNA Methylation and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (gDNA) and total RNA from liver specimens were extracted with an RNA/DNA Extraction Kit (QIAGEN), while a TRI-Reagent solution (Sigma) was used for both extractions from PBMC samples. DNA methylation rates in proximal AE2 promoter regions (upstream AE2a promoter and alternate AE2b1 and AE2b2 promoters within intron 2)[38] (link), [39] (link) were obtained at 1-base pair resolution by pyrosequencing. Briefly, gDNA aliquots (1 μg) were treated overnight with bisulphite (EpiTect-Bisulphite Kit from QIAGEN) and used as template for PCR amplification with primers that match non-CpG regions within the bisulphite converted promoter sequences (see Table S2). 5’-biotinylated reverse primers allowed for resultant amplicons to be immobilized onto streptavidin-coated beads, followed by denaturation in 0.5 M NaOH, and sequencing of biotinylated reverse strands with respective forward primers (using a PyroMarkTM Q96 pyrosequencer and PyroQ-CpGTM 1.0.9 software; Biotage-QIAGEN).
The levels of mRNAs were assessed by real-time PCR in an iCycler iQ5 (BioRad), using reverse-transcribed total RNA and specific primers for AE2a, AE2b1 and AE2b2, and for GAPDH as normalizing control (Table S3). For calculations, we used the Livak/Schmittgen’s method,40 (link) though modified after estimating an average amplification efficiency of 80%, i.e. 1.8–ΔΔCT.
The levels of mRNAs were assessed by real-time PCR in an iCycler iQ5 (BioRad), using reverse-transcribed total RNA and specific primers for AE2a, AE2b1 and AE2b2, and for GAPDH as normalizing control (Table S3). For calculations, we used the Livak/Schmittgen’s method,40 (link) though modified after estimating an average amplification efficiency of 80%, i.e. 1.8–ΔΔCT.
9
Prefrontal Cortex DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On postnatal day 22, we selected female and male offspring from this large breeding as subjects for the current study (n = 5/group/sex, no more than 1 male and 1 female/litter to control for litter effects). Animals were decapitated, and brains were removed and weighed; the prefrontal cortex (PFC) was then quickly dissected and frozen on dry ice in RNA later (Qiagen, Hilden, Germany); Figure 1 . All tissue collected was left at 4 °C for 1 day and then frozen at −80 °C until DNA extraction. Total DNA was extracted from the PFC using the RNA/DNA extraction kit (Qiagen, Hildren, Germany). Cells were mechanically lysed using the Omni Bead Ruptor Elite (Omni International, Kennesaw, GA, USA). DNA concentration was assessed using Qubit Fluorometric Quantitation (Life Technologies, Carlsbad, CA, USA).
10
Quantifying Endocannabinoid Receptor Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNA/DNA extraction kit (Qiagen, Germany). After extraction, RNA was precipitated, washed, and diluted in RNA-free water. RNA quantity was assessed using a NanoDrop™ 8000 Spectrophotometer (Thermo Fisher Scientific), and RNA quality using a 2100 Bioanalyzer Instrument (Agilent Technologies, CA, USA). RT-qPCR was performed as described using iTaq Universal SYBR Green Supermix (Bio-Rad) and cDNA template in a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). RPLP0 mRNAs were used as internal controls for normalization. Primers are listed in Table 1 . Results calculated using the ΔΔCT method are presented as n-fold differences in target gene expression relative to reference gene and calibration sample.
Primers used for qPCR experiments to characterize isoforms of endocannabinoid receptors
| Target | Primer sequence (5′-3′) | Amplicon size | Annealing temperature |
|---|---|---|---|
| CNR1 (CB1) | F: TCAGTACGAAGACATCAAAGGTG | 85pb | 60 °C |
| R: CTTCCCCTAAAGGAAGTTAAAGG | |||
| CB1A | F: AGACATCAAAGGAGAATGAGGAG | 113pb | 60 °C |
| F: AGACATCAAAGGAGAATGAGGAG | |||
| CB1B | F: AGACATCAAAGGAGAATGAGGAG | 84pb | 64 °C |
| R: AATGTTCACCTGGTCTGCTG | |||
| CB2A | F: GATTATGCCAGCCAGATGC | 77pb | 64 °C |
| R: GCTCGGTGAGTGAGAGGTG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!