C57 bl6 and grn mice

C57/BL6 and Grn^-/- mice [40 (link)] were obtained from The Jackson Laboratory. Gba^-/- mice were generated as previously described [41 (link)]. Mixed male and female mice were used for this study.

C57/BL6 and Grn^−/− mice [38 (link)] were obtained from The Jackson Laboratory. Ctsd−/− [39 (link)], Ctsb−/− [40 (link)], Ctsl−/− [41 (link)], Ctsb−/− Ctsl−/− [33 (link)], Ctsk−/− [42 (link)] and Ctsz−/− [43 (link)] mice were characterized previously. PSAP knockout mice were previously described [44 (link)]. All animals (1–6 adult mice per cage) were housed in a 12 h light/dark cycle.

TMEM106B knockout mice were produced using CRISPR/Cas9 genome editing with two guide RNAs (5′‐AGTGAAGTGCACAAC GAAGA‐3′, 5′‐ACCCTATGGGATATATTTAC‐3′) targeting exon 3 of mouse TMEM106B, flanking the start codon. C57BL/6J × FVB/N mouse embryos were injected with gRNAs and Cas9 mRNA at the Cornell Transgenic Core Facility. Editing was confirmed by sequencing PCR products from genomic DNA, and the loss of protein products was determined by Western blot of tissue lysates. Offspring from the founder containing 341 bp deletion were backcrossed to C57BL/6J for seven generations and used for the study. Δ341 bp knockout mouse genotyping was performed by PCR using oligos 5′‐GTGCACAACGAAGACGGAAG‐3′ and 5′‐TGGCAAACCTCAGGCTCATT‐3′ to specifically detect the WT allele (550 bp), and using oligos 5′‐GTTCACCTGCAGTGCCAACT‐3′ and 5′‐TTGTTTGCTTTTGTGTTTCTGA‐3′ to detect the mutant allele (397 bp). C57/BL6 and Grn^−/− mice (Yin et al, 2010a) were obtained from The Jackson Laboratory. All animals (1–6 adult mice per cage) were housed in a 12 h light/dark cycle. Mixed male and female mice were used for this study.