Human CXCL9 and CXCL10 cDNA sequences flanked by XhoI and BamHI restriction sites were acquired as GeneArt™ Strings™ DNA Fragments (Invitrogen). CXCL9 or CXCL10 DNA strings were subcloned into the pLVX-Puro lentiviral expression vector (Clontech) via XhoI and BamHI sites. For combined overexpression of CXCL9 and CXCL10, a pLVX-Hygro lentiviral vector expressing CXCL10 was additionally generated. For this purpose, the pLVX-FADD-DD plasmid was obtained from Addgene, which was a gift from Joan Massagué (Addgene plasmid # 58263)15 (link) and contains the pLVX-IRES-Hygro backbone (Clontech). The FADD-DD insert was replaced by subcloning the multiple cloning site of the pLVX-Puro backbone plasmid via the SnaBI and BamHI restriction sites. CXCL10 cDNA sequence was inserted into pLVX-Hygro via XhoI and BamHI sites.
Plvx puro lentiviral expression vector
Manufactured by Takara Bio
Sourced in United States
The PLVX-Puro lentiviral expression vector is a tool used for the delivery and expression of genes of interest in target cells. It contains a puromycin resistance gene, allowing for the selection of transduced cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Geneart strings dna fragment, by Thermo Fisher Scientific (1 mentions)
Hek293t cell, by American Type Culture Collection (1 mentions)
Plko 1 lentiviral vector, by Addgene (1 mentions)
Blank plvx puro, by Vector Laboratories (1 mentions)
Pcdna3.1 mammalian expression vector, by Thermo Fisher Scientific (1 mentions)
In fusion cloning kit, by Takara Bio (1 mentions)
Ti70 rotor, by Beckman Coulter (1 mentions)
Phanta super fidelity dna polymerase, by Vazyme (1 mentions)
8 protocols using plvx puro lentiviral expression vector
1
Lentiviral Overexpression of CXCL9 and CXCL10
2
Constructing Circularized AR-E3 Expression Plasmid
3
Characterization of TRIM64 and IκBα Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full length of TRIM64 was ligated into pLVX-Puro lentiviral expression vector (Clontech Laboratories, Inc., Mountain View, CA, USA). A short RNA interference sequence targeting human TRIM64 (shTRIM64-1, 5′-GGATTCAGACGACCTGCAA-3′; shTRIM64-2, 5′-GAGACAAGAAACAATCTAA-3′; shTRIM64-3, 5′-GGATAATCACTATTCAATA-3′) was cloned into pLKO.1 lentiviral vector (Addgen, USA). Co-transfection of recombinant lentiviral vectors into 293 T cells with pMD2G and psPAX2 was aided by Lipofectamine 2000. The negative control was pLVX-Puro or pLKO.1-scramble shRNA vector.
Mutant or full-length IκBα cDNA was ligated into pCMV-Tag 2B vectors, and the constructed vector was named IκBα (K22R), IκBα (K38R), IκBα (K67R), and IκBα (WT), respectively. A QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) was used to mutation analysis. Myc-labeled TRIM64 (GENEWIZ, Suzhou, China) was ligated into p-DONR221 vector. His-tagged human ubiquitin (His-Ub) was ligated into pcDNA-DEST40. Each construct was verified by sequencing analysis. Using Lipofectamine 2000, IκBα constructs, His-Ub, and myc-TRIM64 were co-transfected into 293 T cells.
Mutant or full-length IκBα cDNA was ligated into pCMV-Tag 2B vectors, and the constructed vector was named IκBα (K22R), IκBα (K38R), IκBα (K67R), and IκBα (WT), respectively. A QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) was used to mutation analysis. Myc-labeled TRIM64 (GENEWIZ, Suzhou, China) was ligated into p-DONR221 vector. His-tagged human ubiquitin (His-Ub) was ligated into pcDNA-DEST40. Each construct was verified by sequencing analysis. Using Lipofectamine 2000, IκBα constructs, His-Ub, and myc-TRIM64 were co-transfected into 293 T cells.
4
Constructing Circularized AR-E3 Expression Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wildtype circAR-E3 expression plasmid was constructed by inserting DNA sequences corresponding to circAR–E3 along with 50 nt of its endogenous flanking sequences on both sides into the pLVX-puro lentiviral expression vector (Clontech, Catalog No. 632164). In addition, a 40–nt (aaagtgctgagattacaggcgtgagccaccacccccggcc) and a 36-nt (ggctcggcacggtagctcacacctgtaatcccagca) inverted Alu repeats [35 (link)] were inserted 5’ to the 5’-flanking sequences and 3’ to the 3’-flanking sequences, respectively. The mutant circAR-E3 expression plasmid contains mutated splice donor and acceptor to prevent circularization. All plasmids were synthesized at Synbio Technologies and sequence-verified. The plasmids were transfected into LNCaP cells using the Lipofectamine 3000 reagent (Thermo Fisher, Catalog No. L3000015) per instruction of the manufacturer.
5
RNAi-Mediated Knockdown and Overexpression of CCL17 and DUSP6 in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAi (RNA interference) sequences targeting position 227–245 (shRNA-1; 5ʹ-GCTGCCTGGAGTACTTCAA-3ʹ), position 366–384 (shRNA-2; 5ʹ-GCTGCCTGGAGTACTTCAA-3ʹ) or position 379–397 (shRNA-3; 5ʹ-GCAGTTAAATACCTGCAAA-3ʹ) of the human CCL17 gene were cloned into the pLKO.1 lentiviral vector (Addgene, Watertown, MA, USA). For lentiviral production, HEK-293T cells obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) were transfected with 1 μg of the lentiviral vectors for 4 hrs. After incubation for 48 hrs, viral particles in cell culture medium were collected and infected CAFs. CCL17 or DUSP6 overexpression was constructed by cloning full-length human CCL17 or DUSP6 into the pLVX-Puro lentiviral expression vector (Clontech, Palo Alto, CA, USA), and then transfected into 293T cells as above described and used to infect NFs or MCF-7 cells. Cells transduced with pLKO.1-scramble shRNA (shNC) or blank pLVX-Puro (Vector) were used as negative controls.
6
Cloning and Expression of FTO, SREBF1, and MLXIPL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length open reading frames (ORFs) of human FTO, SREBF1, and MLXIPL (ChREBP) genes were amplified from HepG2 cDNA. The ORF of FTO was cloned into a flag-tagged pcDNA3.1 mammalian expression vector (Invitrogen, V790-20). The ORFs of SREBF1 and MLXIPL were cloned into a pLVX-puro lentiviral expression vector (Clontech, 632164). m6A site prediction was conducted by using a sequence-based m6A modification site predictor from the website (http://www.cuilab.cn/sramp ). Then, the m6A site-containing fragment was amplified from HepG2 cDNA and cloned into the pRL-TK vector for dual-luciferase reporter assay. Recombinant adenovirus for FTO overexpression was generated using the AdEasy Adenoviral Vector System (Stratagene, RRID:Addgene_18703 ) in 293A cells. For in vivo FTO overexpression, viruses were used at 5 × 107 pfu/g via tail vein injection. For in vitro transfection using cell lines or primary hepatocytes, viruses were used at the multiplicity of infection of 100. Primers are listed in Supplementary Table S3 .
7
Lentiviral Vector Production and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length nucleotide sequence of EPB41L4A-AS2 (NR_027706.1) was directly synthesized by Sangon Biotech Company and cloned into pLVX-Puro lentiviral expression vector (Clontech) between EcoRI and XbaI sites using an In-Fusion Cloning kit (Clontech). Lentiviruses were produced in 293T cells. Briefly, 293T cells were transiently transfected with pLVX plasmid and the packaging plasmids pLP1, pLP2, and pLP/VSVG using lipofectamine 2000. Lentiviral particles were harvested by collecting the supernatants 72 h later, which were centrifuged at 1500 g for 5 min and filtered through a 0.45 μm filter to remove cellular debris. Then, the crude lentivirus was concentrated by ultracentrifugation at 22,000 rpm for 2.5 h at 4°C, using a Beckman Ti70 rotor. The pellets were resuspended in DPBS and incubated at 4°C overnight. The purified lentivirus was then stored at −80°C.
8
Dab2 Lentiviral Expression and miRNA Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding region fragment of Dab2 was obtained by amplifying mouse cDNA with Phanta® Super‐Fidelity DNA Polymerase (P511‐01; Vazyme), then inserted into the pLVX‐Puro lentiviral expression vector (Clontech, Shiga, Japan). miR‐708 and miR‐CTL plasmids were purchased from GeneCopoeia (Guangzhou, China). The lentivirus of Dab2, miR‐708 and miR‐CTL were separately packaged, transduced, and screened according to standard protocol.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!