Phenol red dye

Manufactured by Merck Group

Sourced in Canada

Phenol red dye is a chemical compound commonly used as a pH indicator in laboratory settings. It is a red/purple-colored dye that changes color depending on the pH of the solution it is added to. Phenol red dye is primarily used to monitor the acidity or alkalinity of a solution.

Automatically generated - may contain errors

Lab products found in correlation

Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions) M 152 micromanipulator, by Narishige (1 mentions) Bf100 50 10, by Sutter Instruments (1 mentions) Micropipette puller, by Sutter Instruments (1 mentions) Picopump pv820, by World Precision Instruments (1 mentions) Ix2 slp, by Olympus (1 mentions) Anhydrous tetrahydrofuran, by Merck Group (1 mentions) Methacryloyl chloride, by Merck Group (1 mentions) Sodium alginate, by Merck Group (1 mentions) Triethylamine, by Merck Group (1 mentions) Cas9 nuclease v3, by Integrated DNA Technologies (1 mentions) High capacity reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Femtojet 4i, by Eppendorf (1 mentions) Cfx96 real time system, by Bio-Rad (1 mentions)

5 protocols using phenol red dye

Knockdown of ift81 and tnnt2a in Zebrafish Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

An antisense morpholino oligonucleotide (MO) targeting the translation-start site (ATG) of ift81 (MO:ift81^ATG) was designed to knockdown the expression of ift81^{9 (link)}. To halt cardiac contractions and fluid flow, we designed a MO targeting the ATG translation-start site of cardiac troponin T type 2a, tnnt2a (MO:tnnt2a^ATG). As a negative control, we used a standard control MO (control-MO) specific to a human beta-globin intron mutation. All MO solutions were synthesized by GeneTools (Oregon, USA). The MO sequences are as follows:
MO:ift81^ATG: 5’-CGATAAATTTAAGCTGTTCGCTCAT-3’MO:tnnt2a^ATG: 5’-CATGTTTGCTCTGATCTGACACGCA-3’Control-MO: 5’-CCTCTTACCTCAGTTACAATTTATA-3’All MO solutions were briefly heated at 65°C and re-suspended in 1X Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO₃)₂, 5.0 mM HEPES, pH 7.6) and 0.1% (w/v) phenol red dye (Sigma-Aldrich), to a final concentration of 8 ng/nL. Embryos at 1–2 cell stage were positioned in individual grooves made on a 1.0% agarose gel and were initially injected at concentrations ranging from 0.5 ng/nL to 6 ng/nL.

Eisa-Beygi S., Benslimane F.M., El-Rass S., Prabhudesai S., Abdelrasool M.K., Simpson P.M., Yalcin H.C., Burrows P.E, & Ramchandran R. (2018). Characterization of endothelial cilia distribution during cerebral-vascular development in zebrafish (Danio rerio). Arteriosclerosis, thrombosis, and vascular biology, 38(12), 2806-2818.

+ Open protocol

+ Expand

Microinjection of DNA Samples into Zebrafish Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA samples were dissolved in PBS (Biolot, Moscow, Russia) containing 0.05% Phenol red dye (Sigma-Aldrich, St. Louis, MO, USA). DNA concentration ranged from 0.3 to 30 attomoles/nL. DNA samples were microinjected into zebrafish embryos at the first cleavage 20 min after fertilization using an M-152 micromanipulator (Narishige, Tokyo, Japan) and an air-pressure injector PicoPump PV820 (World Precision Instruments, Sarasota, FL, USA) under an inverted microscope Olympus IX2-SLP (Olympus, Tokyo, Japan). The samples (1 nL) were injected within 0.28 s into the yolk under the formed germinal disc at an angle of 45° to the plate to maximize sample delivery into the yolk center. The capillaries used with an outer diameter of 20 µm were pulled from glass capillaries (BF100-50-10, Sutter Instrument, Novato, CA, USA) by a Micropipette puller (Sutter Instrument, Novato, CA, USA). A total of 6750 eggs were injected.

Selina P.I., Alekseenko I.V., Kurtova A.I., Pleshkan V.V., Voronezhskaya E.E., Demidyuk I.V, & Kostrov S.V. (2023). Efficiency of Promoters of Human Genes FAP and CTGF at Organism Level in a Danio rerio Model. International Journal of Molecular Sciences, 24(8), 7192.

+ Open protocol

+ Expand

Hydrogel Synthesis and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phenol red dye, methacryloyl chloride, triethylamine (TEA), anhydrous tetrahydrofuran (THF), dimethyl sulfoxide (DMSO), DMSO-d₆, ammonium persulphate (APS), N,N’-methylenebisacrylamide (MBAA), acrylamide (AAm), N,N,N′,N′-tetramethylethylenediamine (TEMED), calcium chloride (CaCl₂), and sodium alginate were purchased from Sigma-Aldrich (Oakville, ON, Canada)and used as received. Potassium sodium buffer solutions with pH values of 5, 6, 7, 7.4, 8, and 9 were obtained from Fisher Scientific (Ottawa, ON, Canada). All other chemicals used in this work were used as received.

Liu L., Li X., Nagao M., Elias A.L., Narain R, & Chung H.J. (2017). A pH-Indicating Colorimetric Tough Hydrogel Patch towards Applications in a Substrate for Smart Wound Dressings. Polymers, 9(11), 558.

+ Open protocol

+ Expand

Morpholino Oligonucleotide Inhibition of Cardiac Troponin T

Check if the same lab product or an alternative is used in the 5 most similar protocols

To stop cardiac contractions and inhibit CVP formation, we used a morpholino oligonucleotide (MO) targeting the ATG translation-start site of cardiac troponin T type 2a, tnnt2a (MO:tnnt2a ATG ). As a negative control, we used a standard control MO (control MO) specific to a human β-globin intron mutation. All MOs were synthesized by GeneTools (Oregon). The MO sequences were: MO:tnnt2a ATG : 5'-CATGTTTGCTCTGATCTGACACGCA-3' Control MO: 5'-CCTCTTACCTCAGTTACAATTTATA-3' Prior to injection, MO solutions were briefly heated at 65°C and resuspended in 1X Danieau's solution (58 mmol/L NaCl, 0.7 mmol/L KCl, 0.4 mmol/L MgSO 4 , 0.6 mmol/L Ca(NO 3 ) 2 , 5.0 mmol/L HEPES, pH 7.6), and 0.1% (w/v) phenol red dye (Sigma-Aldrich), to a final concentration of 8 ng/nL. Embryos at 1-16 cell-stages were positioned in individual grooves made on a 1.5% agarose gel and injected with MOs at concentrations ranging from 0.5 to 6 ng/nL.

Eisa-Beygi S., Hu M.M., Kumar S.N., Jeffery B.E., Collery R.F., Vo N.J., Lamichanne B.S., Yost H.J., Veldman M.B, & Link B.A. (2023). Mesenchymal Stromal Cells Facilitate Tip Cell Fusion Downstream of BMP-Mediated Venous Angiogenesis-Brief Report. Arteriosclerosis, thrombosis, and vascular biology, 43(7).

+ Open protocol

+ Expand

CRISPR/Cas9 Genome Editing in Zebrafish Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

10 -20 zebrafish embryos were pooled and lysed using a 25-gauge needle in Trizol LS for RNA extraction. cDNA was synthesized using a High-capacity reverse transcription kit (ThermoFisher Scientific, 4368814). qPCR was carried out using Power UP SYBR green master mix (ThermoFisher Scientific, 4385610) on a CFX96 Real-Time system (BioRad). TAATACGACTCACTATAGGGATTCGAGAGATGTTACTGTTTTAGAGCTAGAAATA GC. gRNA was synthesized as previously described 24 .
A 1:1 solution of gRNA and 500 µg/mL of Cas9 nuclease V3 (Integrated DNA Technology) was prepared with phenol red dye (Sigma, P0290). Freshly laid eggs were collected from breeding tanks and the solution was injected in the yolk sac of the egg before the emergence of the first cell with a FemtoJet 4i (Eppendorf).

Cholan P.M., Han A., Woodie B.R., Kurz A.R., Britton W.J., Ye L., Holmes Z.C., McCann J.R., David L.A., Rawls J.F., & Oehlers S.H. (2020). Conserved anti-inflammatory effects and sensing of butyrate in zebrafish.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!