Alkali cation yeast transformation kit

The deletion mutants ΔFgcapA and ΔFgcapB were generated using a previously described protocol (Yun et al., 2013). To generate the double mutant of FgCAPA and FgCAPB, FgCAPA was knocked out in the ΔFgcapB mutant and the resulting double mutant was designated ΔΔFgcapA/B. The primers used to amplify the flanking sequences for each gene are listed in Table S1. Deletion mutants were identified by PCR with relevant primers and a Southern blot assay (Fig. S3).
To construct the FgCAPA‐GFP fusion cassette, the FgCAPA fragment containing the native promoter and ORF (without the stop codon) was amplified with primers P17 and P18 (Table S1). The resulting PCR products were co‐transformed with XhoI‐digested pYF11‐GFP plasmid into S. cerevisiae XK1‐25 using the alkali‐cation yeast transformation kit (MP Biomedicals, Solon, USA). The recombined pYF11‐FgCAPA‐GFP plasmid was recovered from the yeast transformant using a yeast plasmid extraction kit (Solarbio, Beijing, China) and then transferred into Escherichia coli strain DH5α for amplification. The recombinant plasmid pYF11‐FgCAPA‐GFP was transformed into the ΔFgcapA mutant for complementation, and the resulting transformant was designated ΔFgcapA‐C. Using the same strategy, the pYF11‐FgCAPB‐GFP recombinant plasmid was constructed and transformed into the ΔFgcapB mutant and generated the complementation ΔFgcapB‐C.

The double-joint PCR method was used to prepare the targeted replacement constructs for the genes of interest (44 (link)). The upstream and downstream fragments of the target genes were amplified with gene-specific primers (Table S2), and the PCR products were transformed into protoplasts of Fon strains (46 (link)). Putative positive transformants were selected on PDA plates supplemented with 100 mg/mL hygromycin B and identified by PCR with gene-specific primer pairs (Table S2), followed by further confirmation using Southern blotting. For construction of complementation vectors, fragments containing an ~1.5-kb native promoter region and ORF (without stop codon) of the genes were cotransformed with XhoI-digested vector pYF11 into yeast strain XK-125 using the alkali-cation yeast transformation kit (MP Biomedicals, Solon, OH, USA), yielding the GFP-tag fused vectors. The recombined vectors were transformed into protoplasts of the corresponding deletion mutants, and neomycin-resistant transformants were characterized by PCR and examined for GFP signal. Site-specific point mutations in FonPAT1, FonPAT2, FonPAT4, and FonAP-2 complex subunits FonAP-2α, FonAP-2β, and FonAP-2μ were created using the Mut Express MultiS fast mutagenesis kit (Vazyme Biotech, Nanjing, China) and cloned into pYF11 for construction of complementation strains (46 (link)).

The deletion of gene CgTPO3 was carried out in the parental strain 51800 using the method described by Reuss et al. (2004) (link). The gene to be deleted was replaced by a SAT1 flipper cassette by homologous recombination using primers 5′ –CCCTCCAATCCAGATTGACGCAGTGGGGTTATAGGTTACTGAGGTGTTTCTATATATACAATGGACGGTGGTATGTTT- 3′ and 5′ –ATATATTATGATTCAATGAGAAGTACATTAGATGTAGGAGGTGGAAGTAAGGGGAGTTGTTTAGGCGTCATCCTGTGCTC- 3′. The underlined region of the primers has homology with the gene to be amplified while the italic region has homology with the SAT1 flipper cassette encoding sequence. The pA83 plasmid including CgSAT1 was used as a template, and transformation was performed using the Alkali-Cation Yeast Transformation Kit (MP Biomedicals). Appropriate PCR products were identified and verified by PCR using the following pairs of primers: 5′ –CAGAATTTGAACCTTCGGTG- 3′ which is assigned to the inside of the open reading frame of CgTPO3, and 5′ –GCCCAGATAACAACACAAGTCC- 3′ which is specific for the cassette DNA. No PCR products were identified from the template DNA of the mutant, while a clear PCR product was identified from the template DNA of the parental strain.

Full-length copies of each gene were re-introduced into gene deletion strains using the yeast GAP-repair approach described by Zhou et al. [51] . A full-length copy of the each gene, including its native promoter, was amplified using the primers shown in Table S2. Competent cell production and transformation of the XK1-25 strain was performed using the Alkali-cation yeast transformation kit (MP Biomedicals).

The S. cerevisiae wild-type strain (BY4741) and ΔScdbr1 strain (YKL149C) were obtained from EUROSCARF (Frankfurt, Germany). The full-length cDNA sequence of FgDBR1 was amplified, digested with EcoRI and XbaI, and inserted into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA). The cloned vector pYES2-FgDBR1 was transformed into the ΔScdbr1 strain using an Alkali-Cation Yeast Transformation Kit (MP Biomedicals, Santa Ana, CA, USA). Additionally, the empty pYES2 vector was introduced into the wild-type and mutant yeast strains. Yeast transformants were selected on synthetic-defined medium lacking uracil (SD-Ura) and further confirmed through PCR amplification of FgDBR1. For complementation assays, each transformant was grown in SD-Ura medium supplemented with 2% galactose overnight at 30 °C in a rotary shaker (200 rpm). Yeast cells were re-inoculated in fresh SD-Ura supplemented with 2% galactose until the optical density at 600 nm reached 0.6–0.8. The cells were harvested through centrifugation, total RNA was isolated, and relative intron lariat levels were analyzed using qRT-PCR. The endogenous S. cerevisiae housekeeping gene actin (ACT1) was used for normalization.