RT-qPCR was performed using N1 and RP CDC primers (2019-nCoV CDC EUA Kit, IDT#10006606). RNA was extracted from patient samples with QIAamp Viral RNA Mini Kit (QIAGEN, # 52906) and used for one-step RT-qPCR in ABI 7500 Fast Real-Time PCR System according to CDC protocols (https://www.fda.gov/media/134922/download ). In brief, 20 µL reaction included 8.5 µL of Nuclease-free Water, 1.5 µL of Primer and Probe mix (IDT, 10006713), 5 µL of TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher, A15299) and 5 µL of the RNA. Nuclease-free water was used as negative template control (NTC). Amplification was performed as follows: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 2 min followed by 45 cycles of 95 °C for 3 s and 55 °C for 30 s. To quantify viral RNA in the samples, standard curve for N1 primers was generated using a dilution series of a SARS-CoV-2 synthetic RNA fragment (RTGM 10169, NIST) spanning N gene with concentrations ranging from 10 to 106 copies per µL. Three technical replicates were performed at each dilution. The NTC showed no amplification throughout the 45 cycles of qPCR.
Abi 7500 fast real time pcr system
Manufactured by Qiagen
Sourced in Germany
The ABI 7500 Fast Real-Time PCR System is a laboratory instrument used for real-time polymerase chain reaction (PCR) analysis. It is designed to perform rapid and accurate quantification of nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Taqpath 1 step rt qpcr master mix, by Thermo Fisher Scientific (2 mentions)
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Sybr green pcr kit, by Qiagen (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Gentra puregene genomic dna purification kit, by Qiagen (1 mentions)
4 protocols using abi 7500 fast real time pcr system
1
SARS-CoV-2 Viral RNA Quantification by RT-qPCR
2
SARS-CoV-2 Viral Load Quantification by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed using N1 and RP CDC primers (2019-nCoV CDC EUA Kit, IDT#10006606). RNA was extracted from patient samples with QIAamp Viral RNA Mini Kit (QIAGEN, # 52906) and used for one-step RT-qPCR in ABI 7500 Fast Real-Time PCR System according to CDC protocols (https://www.fda.gov/media/134922/download ). In brief, 20 μL reaction included 8.5 μL of Nuclease-free Water, 1.5 μL of Primer and Probe mix (IDT, 10006713), 5 μL of TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher, A15299) and 5 μL of the RNA. Nuclease-free water was used as negative template control (NTC). Amplification was performed as follows: 25°C for 2 min, 50°C for 15 min, 95°C for 2 min followed by 45 cycles of 95°C for 3 s and 55°C for 30 s. To quantify viral RNA in the samples, standard curve for N1 primers was generated using a dilution series of a SARS-CoV-2 synthetic RNA fragment (RTGM 10169, NIST) spanning N gene with concentrations ranging from 10 to 106 copies per μL. Three technical replicates were performed at each dilution. The NTC showed no amplification throughout the 45 cycles of qPCR.
3
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen) from the tissue homogenates and cells. RNA was used to synthesize cDNA according to the instructions of the reverse transcription kit (Takara, Japan). Expressions of the target genes and housekeeping gene (GAPDH) were examined using the SYBR-Green PCR kit (Qiagen, Hilden, Germany) on the ABI 7500 Fast Real-Time PCR system. Relative expression levels of the target genes were analyzed using the 2−ΔΔCt calculation method.16 (link) All primers used in this experiment are listed in Table 1 .
Primers Used in Realtime PCR in This Study
| ID | Sequence (5ʹ- 3ʹ) | Length (bp) |
|---|---|---|
| GAPDH F | TGTTCGTCATGGGTGTGAAC | 154 |
| GAPDH R | ATGGCATGGACTGTGGTCAT | |
| Beclin-1 F | AGGTTGAGAAAGGCGAGACA | 133 |
| Beclin-1 R | GTCCACTGCTCCTCAGAGTT | |
| VPS53 F | TGTTCCCAACCGAGCAATCTC | 115 |
| VPS53 R | ACGTTCGTCTGACCTCTTACA |
4
DNA Extraction and qPCR Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All DNA extractions and qPCR protocols performed in the laboratory were completed as described (Muller et al. 2013) . In brief, DNA extraction was initiated with a commercial kit (Gentra Puregene Genomic DNA Purification Kit, Qiagen) according to the manufacturer's instructions. Genomic DNA from the resulting lysate was further purified with a second kit (OmniPrep for Fungi, G-Biosciences, Maryland Heights, Missouri, USA), following the manufacturer's instructions beginning at the chloroform extraction step. Assays were conducted using the ABI 7500 Fast Real-Time PCR System with assays consisting of 5 lL of DNA extract, 12.5 lL of 23 Qiagen DNA master mix, 0.5 lL of 503 ROX dye solution, 0.5 lL of 203 forward and reverse primers (20 lM), and 0.25 lL of probe (primers and probe at 20 lM; QuantiFast Probe PCRþROX Vial Kit, Qiagen). The PCR cycling conditions included an initial Taq polymerase activation step of 95 C for 3 min, followed by 40 cycles of denaturation at 95 C for 3 s and annealing at 60 C for 30 s. Similar to the field-based approach described earlier, any reactions that crossed the threshold baseline within 40 cycles were considered positive. Unlike the fieldbased approach, negative controls were run for all the benchtop assays.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!