Tb green premix ex tag 2

Second passage cells were treated with inhibitors until they reached 80% confluence. At the end of experiments, cells were washed with PBS and treated with TRIzol (TaKaRa; Cat. No. 9109), and RNA was extracted according to the manufacturer’s protocol. The NanoVne instrument (GE Healthcare) was used to measure the purity. Samples with A260/280 values between 1.8 and 2.0 were used for subsequent experiments. The Prime Script RT Master Mix (TaKaRa; Cat. No. RR036A) was used for reverse transcription, and TB Green Premix Ex Tag II (TaKaRa; Cat. No. RR820A) was used for amplification on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). Thermocycling conditions were as follows: 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 35 s. The obtained Ct values were normalized using the 2^–ΔΔCt formula, with GAPDH as the housekeeping gene. The primer sequences are listed in the Supplementary Figure 2.

The expression levels of ZFAS1, CCND2 and miR‐150‐5p were determined using qRT‐PCR. Total RNA from the left ventricular tissue and cardiomyocytes was extracted using the TRIzol reagent (Invitrogen), first‐strand complementary DNA was extracted using the PrimeScript RT Reagent Kit with gDNA Eraser and TB Green Premix Ex Tag II (TaKaRa Bio, Japan), and miRNA was extracted from total RNA using the Mir‐X miRNA First‐Strand Synthesis Kit and Mir‐X miRNA qRT‐PCR TB Green Kit (TaKaRa Bio, Japan). β‐Actin was used as an internal control in the determination of ZFAS1 and CCND2 expression, whereas U6 was used in the case of miR‐150‐5p expression. qRT‐PCR was performed according to the manufacturer's protocol using a QuantStudio 5 Real‐Time PCR System (Thermo Fisher Scientific, USA). The following primer sequences were employed: ZFAS1 (forward: 5′‐ACGTGCAGACATCTACAAC CT‐3′ and reverse: 5′‐TACTTCCAACACCCGCAT‐3′); miR‐150‐5p (forward: 5′‐TCGG CGTC TCCC AACC CTTG TAC‐3′ and reverse: 5′‐GTCG TATC CAGT GCAG GGTC CGAG GT‐3′); and CCND2 (forward: 5′‐AGAGCCACCGGTATGGAGCTGCTGTGCCACGAGGT‐3′ and reverse: 5′‐CTGCAGGCGCGCCGAATTTTTTTTTTAAGTTTCACCCT‐3′).

Cells were collected in RLT buffer and then homogenized by QIAshredder (Qiagen #79656). Total RNAs were isolated with RNeasy Mini Kit (Qiagen #74106) following the manufacturer’s guidelines and then reverse-transcribed to cDNA by PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara, #6210A). qPCR was performed using a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) and using TB Green Premix Ex Tag II (Takara, #RR820). Primers are described in Supplementary Table S3.

Total RNA was extracted using RNAiso Plus (Takara Bio, Kusatsu, Japan). Purity was assessed through measurement of the A260/A280 ratio. Complementary DNA was synthesized using Prime Script™ RT Master Mix (TaKaRa Bio). Quantitative reverse-transcription PCR (qRT-PCR) was performed using the 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with TB Green^@ Premix Ex Tag™ II (TaKaRa Bio). The thermocycling conditions were as follows: 95°C for 30 s, 40 cycles at 95°C for 5 s, and 60°C for 35 s. The housekeeping gene was GADPH. Relative gene expression was calculated using 2^−ΔΔCt. The primer sequences are listed in Supplementary Figure S2.