The largest database of trusted experimental protocols

Pcagig

Manufactured by Addgene
Sourced in United States

The PCAGIG is a laboratory instrument used for DNA and RNA analysis. It functions as a polymerase chain reaction (PCR) thermal cycler, which is a device that automates the thermal cycling process essential for DNA and RNA amplification.

Automatically generated - may contain errors

9 protocols using pcagig

1

Cloning and Optimization of Prdm16 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length sequence of Pdzrn3 was cloned into the
EcoRI and NotI sites of pGAGIG (Addgene). To generate the Hes5p-Prdm16
F.L.
-IRES-GFP and
Hes5p-ΔPRdm16-IRES-GFPvectors, the proximal promoter region of Hes5 (−685 to
+28 bp from TSS) was PCR-amplified from Hes5p-Luc plasmid
(Addgene) and cloned into the Sal I and EcoRI sites of pCAGIG (Addgene),
resulting in replacement of the entire CAG promoter by the Hes5promoter (Hes5p-IRES-GFP control vector). The
full length coding sequence of Prdm16 was obtained from the
pcDNA3.1-Prdm16 vector (Addgene). To optimize mRNA translation, we changed the
sequence immediately upstream of the start codon (GTAGTCATG) to
a consensus Kozak sequence (GCCACCATG) using QuikChange II
site-directed mutagenesis (Agilent). Kozak-corrected Prdm16 was
cloned into the EcoRI site of the control vector to generate the
Hes5p-Prdm16 F.L.-IRES-GFP final vector.
An in-frame deletion of the nucleotide sequence coding for the entire PR domain
of PRDM16 (amino acids 82–211, based on UniProt) was done with the Q5
site-directed mutagenesis kit (New England Biolabs) to generate the
Hes5p-ΔPRdm16-IRES-GFPvector. The sequence of all vectors was confirmed using custom primers. Antibody
staining was necessary to detect GFP expression from these
vectors. For simplicity, vectors are indicated as Hes5p-Prdm16F.L. and Hes5p-ΔPRdm16 in the main
text.
+ Open protocol
+ Expand
2

Construct Generation and Validation of Rbms1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Various DNA constructs were prepared by the subcloning of either the open reading frame (ORF) or knockdown oligomers in the corresponding expression plasmid vectors in (Table 1). The expression vector was produced by subcloning of the ORF of mouse Rbms1 (NCBI accession No. NM_001141931) into the base vector pCAGIG (Connie Cepko [plasmid #11159]; Addgene, USA) and that for the knockdown vector by inserting 19-mer shRNA oligonucleotide of 5’ GGAGACGTCTAATGACCATTC 3’ into pGPH1/GFP/Neo vector (Bicistronic GFP shRNA vector; GenePharma, China). FLAG-tagged Rbms1 expression vector were prepared by subcloning of Rbms1 ORF into the N-terminal FLAG vector, pCMV3-N-FLAG. The mouse Rbms1 addback vector was generated by mutating four nucleotides of shRbms1 targeting sequence in complete ORF of mouse Rbms1; the sequence changes were as 5’ G/AGAG/AACGTCT/GAATGACCAT/CTC 3’, without changing their coding amino acids. The mutant subcloned into pCAGIG by Enzynomics (Korea).
+ Open protocol
+ Expand
3

Plasmid construction and screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
The plasmid vector pRSET-B (Invitrogen) was used for the library generation, bacterial screenings and protein production. pcDNA 3.1+ (Invitrogen) and pCAGIG (Addgene, USA) were the expression vectors used for the studies in mammalian cells. All constructs were cloned using the homology-based SLiCE methodology41 (link). Briefly, fragments were amplified by PCR containing 20 nucleotides overhangs overlapping with the required upstream and downstream sequences. SLiCE extract was prepared as suggested by the authors and 10 µl reactions were used with a vector/insert ratio of 1:1. E. coli XL1 Blue cells (Invitrogen) were used for all cloning steps and library screenings. Error-prone PCR mutagenesis was performed using the GeneMorph II Random mutagenesis kit (Agilent, Germany). Standard PCR reactions for cloning or site-mutagenesis were done using Herculase II Fusion polymerase (Agilent, Germany). All primers were ordered from Eurofins Genomics, Germany.
+ Open protocol
+ Expand
4

Modulation of Cell Fate Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells (ATCC, HB-8065) were cultured in Eagle’s Minimum Essential Medium (Quality Biological, 112-018-101CS) supplemented with 1x GlutaMAX (ThermoFisher Scientific, 35050061), 10% FBS (Corning, 35-010-CV) and 1% Penicillin-Streptomycin (ThermoFisher Scientific, 15070063). siRNA targeting PTBP1 (Sigma, SASI_Hs01_00216644) or eGFP as negative control (ThermoFisher Scientific, AM4626) were transfected using Lipofectamine 3000 (Thermo Fisher Scientific, L3000-008) following the manufacturer’s protocol. For overexpression of MSI1 and PCBP2, Ultimate ORF expression clones from ThermoFisher Scientific (MSI1 - IOH41182, PCBP2 - IOH4487) were cloned into pCAGIG (Addgene, 11159) and again transfected using Lipofectamine 3000. For experiments involving a combination of plasmid overexpression and siRNA knockdown, plasmids were first transfected at 0 h, siRNA were transfected at 24 h, and cells were processed two days later at 72 h. For FACS isolation, cells were dissociated using TrypLE (ThermoFisher Scientific, 12604013) to form a single-cell suspension and sorted by GFP fluorescence on a BD FACSCalibur in the JHMI Ross Flow Cytometry Core Facility.
+ Open protocol
+ Expand
5

Cloning and Expression of sMarf1 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The sMarf1 open reading frame (ORF) was amplified from cDNA obtained from mouse cortical neurons using specific primers (Forward: 5′-CCATATTGTCTGGCTATGT-3′, Reverse: 5′-TCCATGTTCAAATGGGAG-3′). Then, cDNA was cloned into a pCR Blunt II TOPO vector (Thermo Fisher Scientific) with the restriction enzyme sites NotI and XhoI. Next, the sMarf1 ORF was inserted into a pCAGIG (Addgene) vector by restriction enzyme digestion using a DNA ligation kit ver. 2.1 (TaKaRa). To add the V5-tag to the C-terminus of sMarf1, the sMarf1 ORF was subcloned into a pcDNA3.1/V5-His TOPO vector (Thermo Fisher Scientific). In parallel, to establish the ΔNYN sMarf1 construct, the sMarf1 ORF was amplified using specific primers (Forward: 5′-CACCATGGGCCACACTCTACTCTAT-3′, Reverse: 5′-TTTAAGCTTGGTTACAGGTGCAAAAG-3′), and the product was cloned into the pcDNA 3.1/V5-His TOPO vector. Finally, to express the proteins in neuronal cells, both reading frames were transferred to a pCAGIG vector containing a V5 epitope tag. For the construction of the sMarf1 shRNA vector, oligos (Sense: 5′-GATCCCCACACCTCACTTGTGCACCATTCAAGAGATGGTGCACAAGTGAGGTGTTT-3′, Anti-sense: 5′-AGCTTAAAAAACACCTCACTTGTGCACCATCTCTTGAATGGTGCACAAGTGAGGTGT-3′) were designed using OligoEngine software. The oligos were annealed and cloned into a pSUPER retro.neo + gfp vector (Addgene).
+ Open protocol
+ Expand
6

METTL7B cDNA Expression and Pulldown

Check if the same lab product or an alternative is used in the 5 most similar protocols
For expression of METTL7B, full length cDNA (NM_152637.2) was inserted into pCAGIG (a gift from Connie Cepko, Addgene #11159) (Matsuda and Cepko, 2004 (link)). For lentiviral generation, pFUGW (a gift from David Baltimore, Addgene #14883) (Lois et al., 2002 (link)) was digested with PacI, 3’ overhangs removed with Klenow (NEB) to form blunt ends, and additionally digested with BsrGI to release hUBC promoter and EGFP. The CAG-IRES-EGFP was removed from pCAGIG and ligated into pFUGW. For protein pulldown experiments, BirA-HA and HaloTag constructs were PCR-amplified from pcDNA3.1-MCS-BirA(R118G)-HA (a gift from Kyle Roux, Addgene #36047) (Roux et al., 2012 (link)) and pHTC-CMVneo-HaloTag (G7711, Promega), respectively, and ligated into pFUGW-CAG.
+ Open protocol
+ Expand
7

Cardiac Gene Manipulation via AAV

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA candidates were designed to target 21 base-pair gene-specific regions (Invitrogen). The miR-155 backbone based shRNA cassette was inserted at the 3 prime end of the AAV-cTnT-EGFP vector. EGFP was replaced by Bmp7, Yy1 and Ccnd1 for gain of function studies. The sequences of shRNAs and cloning primers are as follows:
Lmna shRNA-1agtctcgaatccgcattgaca
Lmna shRNA-2ggctaagaagcagcttcagga
LacZ shRNAaaatcgctgatttgtgtagtc
Bmp7 shRNActagtggaacatgacaaagaa
Ctgf shRNAcctgtcaagtttgagctttct
Ccnd1 shRNAcagatgtgaagttcatttcca
Bmp7-Fccggctagcatgcacgtgcgctcgctgcgcg
Bmp7-Rccgggtaccctagtggcagccacaggcccggac
Yy1-Fgggcaattgatggcctcgggcgacaccctctacat
Yy1-Rgggggtacctcactggttgtttttggctttagcg
Ccnd1-Fccccaattgatggaacaccagctcctgtgctg
Ccnd1-Rcccggtacctcagatgtccacatctcgcacgtcg
Promoter regions (~ 1 kb) of Bmp7 or Ctgf were amplified from C57BL/6JINV (Jax) mouse genomic DNA and cloned into pCAG-Cherry (Addgene plasmid # 73978) by replacement of the CAG promoter. Tgfb1, Bmp7 and Yy1 were amplified from mouse heart cDNA and cloned into pCAGIG (Addgene Plasmid #11159). Promoter cloning primers are as follows:
Bmp7-Fatagctagcaaaaatccaagcctggacctcagta
Bmp7-Rtattctagagagtggatctggctgagtcttcttg
Ctgf-Fataactagtaaaaatccaagcctggacctcagta
Ctgf-Rtatactagtgagtggatctggctgagtcttcttg
+ Open protocol
+ Expand
8

Mouse Aldh1a3 Expression Vector Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
For construction of expression vectors, full-length cDNAs (mouse Aldh1a3, Clone ID 6515355, purchased from GE Healthcare) were inserted into pCAGIG vector (pCAGIG was obtained from Addgene (Plasmid #11159).
+ Open protocol
+ Expand
9

Prdm16 Overexpression and shFlrt3 Cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pCAGIG plasmid (Addgene plasmid #11159) was inserted with a fragment encoding a nuclear localization signal (NLS) and 3×Flag in the EcoRI site. To make pCAGIG-Prdm16-FL or pCAGIG-Prdm16-PRdeletion, the full-length open reading frame (ORF) or the truncation that lacks the coding sequence for amino acids 2-180 of Prdm16 was PCR amplified from MSCV-Prdm16 (Addgene plasmid #15504) and inserted between the EcoRI and XhoI sites in pCAGIG-NLS-Flag. The VP64 fragment was then inserted to the XhoI site of pCAGIG-Prdm16 to make pCAGIG-FL-VP64.
The plasmids used for making stable cell lines, pCDH-Prdm16 and pCDH-Prdm16-PRdeletion, were generated as follow: The Prdm16 FL ORF, the PR-deletion coding sequences or the NLS-3×Flag was digested from their pCAGIG plasmids and inserted sequentially to the pCDH-CMV-MCS-EF1-Puro plasmid (System Biosciences) between the EcoRI and NotI sites (for Prdm16-FL and Prdm16-PRdeletion) and the XbaI and EcoRI sites (for NLS-3×FLAG).
To clone shFlrt3, annealed oligos were cloned into the HpaI and XhoI sites of the lentiviral vector pLL3.7, which contains a separate CMV promoter that drives the expression of dsRed. Flrt3 shRNAs effectively suppressed co-expressed Flag-FLRT3 protein in HEK293T cells.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!