Total RNA was extracted from the liver tissue according to the TRIzol kits manufacturer’s protocol (TaKaRa, Dalian, China). The RNA concentration was quantified by spectrophotometer (Eppendorf-Biotech, Hamburg, Germany). The RNA samples (2 mg) were reverse transcribed according to the manufacturer’s instructions of the cDNA synthesis kit which was purchased from Applied Biosystems Co. Ltd. (UK). The RT-PCR was performed to analyse the gene expression by the MyiQ2 Real-time PCR system (Bio-Rad, Hercules, USA). PCR reaction used 5μM primers, 10 ng sample cDNA, and 10μL SYBR Mix. PCR reaction conditions include an initial denaturing cycle at 95 oC for 5 min, followed by 40 amplification cycles: 15 s at 95 oC and 45 s at 60 oC. The primer (Table 1) of a sterol regulatory element binding protein 1c (SREBP-1c) and liver X receptor-α (LXR-α) was used from the previous study [16 (link), 17 (link)]. The gene expression was analyzed according to the previous study [18 , 19 (link)].
Trizol kit
Manufactured by Takara Bio
Sourced in China, Japan
The TRIzol kit is a reagent used for the isolation and purification of total RNA from a variety of biological samples. It is a single-step method that combines phenol and guanidine isothiocyanate to effectively lyse cells and isolate RNA.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (10 mentions)
Mastercycler nexus x2, by Eppendorf (7 mentions)
Reverse transcription kit, by Takara Bio (7 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (5 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Primescript rt master mix, by Takara Bio (3 mentions)
Abi 7500 system, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Sybr premix ex taq 2, by Takara Bio (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
Sybr premix ex taq, by Takara Bio (3 mentions)
Takara rt reagent, by Takara Bio (3 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
Primescript rt kit, by Takara Bio (2 mentions)
Cdna reverse transcription kit, by Takara Bio (2 mentions)
Primescripttm rt reagent kit, by Takara Bio (2 mentions)
Primescript rtase mix, by Takara Bio (2 mentions)
118 protocols using trizol kit
1
Liver Gene Expression Profiling
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol kits (TaKaRa, Dalian, China) were used to extract total RNA from samples. Extracted RNA was treated with RNase R at 37 °C for 15 min, and the TaKaRa PrimeScript RT Kit (TaKaRa, Dalian, China) was used to synthesize cDNA. The general reverse transcription system included 500 ng of total RNA, 2 μL of 5 × Mix, 0.5 μL of Random6 primer, 0.5 μL of oligodT primer, and ddH2O to a final volume of 10 μL. The reverse transcription temperature program was 37 °C for 15 min, 85 °C for 5 s, and storage at 4 °C. The real-time fluorescent quantitative PCR instrument was a Bio-Rad CFX96 (Hercules, CA, USA). The reaction system volume was 25 μL, including 12.5 μL of SYBR Premix Ex Taq II, 10 ng of cDNA and 10 μmol/L upstream and downstream primers, and ddH2O was added to a final volume of 25 μL. The qRT–PCR (Thermo Fisher, Waltham, MA, USA) program was as follows: 95 °C for 30 s; 39 cycles of 95 °C for 5 s and 60 °C for 30 s; and 95 °C for 10 s and 65 °C for 5 s. Relative abundance was calculated using 2−ΔΔCT, and UXT was used as the internal control gene (Table S4 ).
3
Cardiac Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of heart tissue was extracted using the Trizol kits (TaKaRa Bio Inc, Japan) and reverse-transcribed into cDNA with the QuantiTect Reverse Transcription Kit (TaKaRa Bio Inc). RT-PCR was conducted with a TB Green Premix Ex Taq II (TaKaRa Bio Inc) using a LightCycler 96 System (Roche). β-Actin was used as the internal reference. The 2−ΔΔCt method was used to calculate the fold changes. PCR primer sequences are shown in Table 3 .
4
Isolation and RNA extraction of rice pathogens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the isolates were collected from rice fields in Libo City (GZLBo), Pingtang City (GZPTang), and Duyun City (GZDYun) of Guizhou Province; Longchuan City (YNLChuan), Zhaotong City (YNZTong), and Yuanjiang City (YNYJiang) of Yunnan Province; Luxi City (JXLXi) of Jiangxi Province; and Jianghua City (HNJHua) of Hunan Province. An artificial inoculation in the seeding stage conducted in a greenhouse was also chosen (GZZCD). All infected leaves were frozen and stored at −80 °C. Total RNAs were extracted from the rice leaves using a Trizol kit (TAKARA, Dalian, China) following the manufacturer’s instructions.
5
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and corneas using a TRIzol kit (TAKARA, Otsu, Shiga, Japan). Subsequently, formaldehyde gel electrophoresis was used to verify the reliability of the obtained RNA. Reverse transcription was then performed using the PrimeScript RT kit (TAKARA) in strict accordance with the instructions. mRNA expression was quantified by standard real-time quantitative PCR (qPCR) methods using SYBR Premix Ex Taq (TAKARA). β-Actin was used as a reference gene. Primers are shown in Table 1 .
6
Quantifying Gene Expression via RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells was extracted with Trizol kit (TaKaRa, Shiga, Japan). A total of 1ug RNA was reverse-transcribed to synthesis complementary DNA (cDNA) using PrimeScript RT reagent Kit (TaKaRa). The cDNAs were quantified by quantitative PCR (qPCR) with SYBR Green real time quantitative PCR kit (TaKaRa). β-actin was used as an internal control. The primers used in the study were shown in Table S1. Each sample was analyzed in triplicate. Relative expression levels from three independent experiments were calculated with the 2-△△CT method.
7
Quantitative Analysis of PROX1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using the TRIzol kit (Takara, Dalian, China) as described previously (18 (link)). 1 μg RNA was used to transcribe cDNA using the HiScript II Q RT SuperMix (R223-01, Vazyme). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using a qTOWER384G(analytikjena). The results were analyzed using the 2-ΔΔCt method and GAPDH as an internal reference. The primers used in the study were as follows:
PROX1Forward Primer: AAAGGACGGTAGGGACAGCAT, Reverse Primer: CCTTGGGGATTCATGGCACTAA; GAPDH Forward Primer: ATGGGGAAGGTGAAGGTCG, Reverse Primer: GGGGTCATTGATGGCAACAATA.
PROX1Forward Primer: AAAGGACGGTAGGGACAGCAT, Reverse Primer: CCTTGGGGATTCATGGCACTAA; GAPDH Forward Primer: ATGGGGAAGGTGAAGGTCG, Reverse Primer: GGGGTCATTGATGGCAACAATA.
8
Phytochemicals from Rhubarb Inhibit Fibrosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rhubarb, purchased from Xuzhou traditional Chinese medicine factory (China) was identified as the dried roots of Rheum palmatum L. by Dr. Huankai Yao. Standard chemicals of five FARs (aloe-emodin, emodin, rhein, chrysophanol, and physcion) were obtained from Sichuan Weikeqi Biological Technology Co., Ltd (Sichuan, China) and resolved in methanol (MeOH) as the control solution. Rat MCs (No. HBZT-1) were obtained from Wuhan Boster Biological Technology Co. (Wuhan, China). DM130 macroporous resins were bought from Anhui Sanxing resin Biological Technology Co., Ltd (Anhui, China). Cell Counting Kit-8 (CCK-8) was purchased from DOJINDO Chemistry Institute (Japan). The TRIzol kit and cDNA reverse transcription kit were obtained from TAKARA Bio Inc (Japan). The rat TGF-β1, CTGF, FN and ColIV ELISA kits were purchased from R&D Systems Inc (USA). Methanol was chromatographic grade. All solvents used for preparation and separation of crude samples were of analytical grade.
9
Fetal Qinchuan Cattle Muscle Transcriptomics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Skeletal muscle samples from 48 male and 37 female fetal Qinchuan cattle were obtained for genomic DNA and total RNA isolation to detect the correlation between mutations and relative mRNA expression levels. Different tissue samples, including skeletal muscle, liver, heart, kidney, lung and spleen from fetal (5 months of gestation) and adult (24 months old) of Qinchuan cattle (n = 5, respectively) were collected for total RNA isolation to evaluate tissue expression.
Total RNA was extracted from different tissues using the Trizol kit (Takara, Japan). cDNA was synthesized according to the PrimeScript RT Reagent Kit (Perfect Real Time) (Takara, Japan). Genomic DNA from skeletal muscle was extracted by proteinase K digestion, chloroform extraction and absolute ethanol precipitation.
Total RNA was extracted from different tissues using the Trizol kit (Takara, Japan). cDNA was synthesized according to the PrimeScript RT Reagent Kit (Perfect Real Time) (Takara, Japan). Genomic DNA from skeletal muscle was extracted by proteinase K digestion, chloroform extraction and absolute ethanol precipitation.
10
Quantifying AhATL1 Expression in Peanut and Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from peanut leaf or Arabidopsis thaliana rosette leaf tissue after various treatments using a TRIzol Kit (TaKaRa), and a Prime Script TM RT Reagent Kit (Perfect Real Time, TaKaRa) was used for RT. Real-time quantitative PCR (qRT-PCR) was performed with the ChamQ SYBR qPCR Master Mix (Low ROX Premixed, Vazyme Biotech Co., Ltd) in an ABI 7500 system to quantify AhATL1 transcript levels. Each reaction consisted of 10 ng cDNA, 0.05 mM primers and 5 μL 2 × ChamQ SYBR qPCR Master Mix in a final volume of 10 μL. The reactive cycle consisted of 95°C for 30 s, then 40 cycles of 95°C for 5 s and 60°C for 34 s. Gene expression level was calculated using the relative 2-ΔΔCT method (Li et al., 2013 (link)). Expression data for A. hypogaea and A. thaliana were normalized using the geometric mean (geomean) of the validated housekeeping genes AhACTIN and AtACTIN2, respectively, as described (Su et al., 2015 (link); Li X. et al., 2016 (link)). Primers are listed in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!