Ambion ribopure kit

Each muscle sample (N = 56, 28 HIGH and 28 LOW) was individually submerged in liquid nitrogen and grinded with a mortar and a pestle to produce a homogenous powder. This powder was submerged in TRIzol reagent (Thermo Fisher Scientific, Barcelona, Spain) and homogenized with a Polytron device (IKA, Staufen, Germany). Total RNA was purified with the Ambion RiboPure kit (Thermo Fisher Scientific, Barcelona, Spain) by following the instructions of the manufacturer. RNA samples were resuspended in a buffer solution provided in the kit and kept at − 80 °C until use. RNA quantification and purity were assessed with a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Barcelona, Spain), while integrity was checked with a Bioanalyzer-2100 equipment (Agilent Technologies, Santa Clara, CA). All samples showed an RNA integrity number above 7.5. Sequencing libraries were prepared with the TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA) and sequenced in a paired-end mode (2 × 75 bp), multiplexing two samples in each sequencing lane, on a HiSeq2000 Sequencing System (Illumina, San Diego, CA). Library preparation and sequencing were developed according to the protocols recommended by the manufacturer.

Type 1 piliated UPEC strains were pelleted and exposed for 2 h at 37°C, static, to LB, fU, fUG, or fUGal or in separate experiments to LB, mU, or mUG. Bacterial RNA was extracted using Ambion Ribopure kit (Thermo Fisher Scientific) and treated with DNase. The quality (A₂₆₀/A₂₈₀) and quantity of extracted RNA was determined by NanoDrop (Synergy HTX multi-mode microplate reader; BioTek). Next, 1 μg total RNA was reverse transcribed using the Applied Biosystems high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific). qRT-PCR was carried out using Power SYBR green master mix (Applied Biosystems) in StepOne Plus thermal cycler (Applied Biosystems). List of primers used for qRT-PCR is shown in Table 5. Relative quantification (RQ) values were calculated by comparative threshold cycle (ΔΔC_T) algorithm (34 (link)) with normalization to 16S rRNA. RQ fold differences over transcript levels from LB-control are presented as averages from at least two biological replicates (each with three technical repeats) ± standard deviations.

Total RNA was isolated using the Ambion Ribopure kit (Thermo Scientific, Rockford, IL, USA) according to the manufacturer’s protocol. cDNA synthesis was performed using Superscript II (Invitrogen, Carlsbad, CA, USA). Quantitative PCR was performed on a Lightcycler 480 (Roche, Mannheim, Germany) using SYBR Green I Master Taq (Roche Applied Science, Mannheim, Germany), with fluorescence measured at the end of each elongation step to calculate Ct values. Relative quantitation of gene expression was determined using the comparative Ct method. Signals for ribosomal 18S amplified in parallel were used to normalize for differences in the amount of starting cDNA. Primers used were; USP4-F: AGCAAGAATCTGAGGCCTGT, USP4-R: GGGTCTCCATGGTGGTGAAG, AQP2-F: TGGCTGTCAATGCTCTCCAC, AQP2-R: GGAGCAGCCGGTGAAATAGA, 18s-F: AGTTCCAGCACATTTTGCGAG, and 18s-R: TCATCCTCCGTGAGTTCTCCA.

At the midpoint of ileum samples of about 1 cm were collected, snap frozen in 1 mL of RNA later (Deltalab, Spain) and stored at  − 80 °C for subsequent RNA isolation and gene expression analysis.
A sample of 50 mg of ileum tissue was submerged in 1 mL of TRIzol Reagent (Thermo Fisher Scientific) and homogenized with a Polytron device (IKA, Staufen, Germany). Total RNA was obtained with the Ambion RiboPure kit (Thermo Fisher Scientific), by following the manufacturer’s protocol. RNA concentration was measured with a NanoDrop ND-1000 spectrophotometer (NanoDrop products) and RNA purity was checked with Agilent Bioanalyzer-2100 equipment (Agilent Technologies), according to the producer’s protocol. All samples showed an RNA integrity number higher than 8.
Between 0.8 and 1 µg of total RNA was reverse-transcribed into cDNA with random primers using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems) in a final volume of 20 µl. The following thermal profile was applied: 25 °C 10 min; 37 °C 120 min; 85 °C 5 min; 4 °C hold. A negative control was performed with no reverse transcription (−RT control) to test the possible residual genomic DNA amplification. cDNA samples were stored at  − 20 °C until use.

Total RNA from frozen kidney samples were prepared using the Ambion RiboPure Kit (Thermo Fisher Scientific, Scoresby, Victoria, Australia) following by random primer-based reverse transcription (SuperScript III First-Strand Synthesis System, Thermo Fisher Scientific, Waltham, MA, USA). PCR reactions were run on the StepOne Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) using Taqman probes. The primer/probes for NOS2 and α-SMA have been described [38 (link),46 (link)]. The other primer/probes were purchased from Thermo Fisher Scientific. The relative amount of mRNA was determined using the comparative Ct (ΔCt) method. All amplicons were normalized against 18S, which was analyzed in the same reaction as an internal control.

Samples of wound tissue were homogenized in Tri-Reagent using a Tissumizer rotor-stator homogenizer (Teledyne Tekmar, OH). RNA was isolated by either chloroform phase separation with an Ambion Ribopure kit (Life Technologies, NY), or directly from Tri-Reagent with a Direct-Zol miniprep plus kit (Zymo Research, CA), and subsequently reverse transcribed into cDNA using iScript supermix (Bio-Rad, CA). Genes of interest were then assayed by qPCR using mouse TaqMan probes for STAT4 (Mm00448890_m1) Ccl2 (Mm00441242_m1) and Ccr2 (Mm00438270_m1) (Life Technologies, NY) with JumpStart Taq polymerase (Sigma-Aldrich, MO), 3 mM MgCl₂, and 200 μ M dNTPs (Promega, WI) using a Bio-Rad CFX96 C1000 thermocycler. A standard TaqMan cycling protocol was performed, consisting of a 10 min 95°C hold, followed by 40 rounds of 15 sec at 95°C and 1 min at 60°C. 18s expression was used as a housekeeping control for data normalization.