Superscript 4 kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, China

The SuperScript IV kit is a reverse transcription system designed for the synthesis of first-strand cDNA from RNA templates. The kit includes the SuperScript IV Reverse Transcriptase enzyme, which is a thermostable, RNase H-minus variant of the M-MLV reverse transcriptase.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

115 protocols using superscript 4 kit

Quantitative Analysis of miR-30e-5p and SP1 in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol (Invitrogen) was used to lysate HUVECs. The RNA extraction kit (Tiangen Biotech Co., Ltd.) was used to extract total RNA. The SuperScript IV kit (Thermo Fisher Scientific) was used for reverse transcription according to the provided instructions. cDNA was synthetized at 50°C for 10 min and at 80°C for 10 min. The qPCR was performed according to the PowerUp™ SYBR™ Green Master mix (Thermo Fisher Scientific, Inc.) and ABI ViiA 7 System (Thermo Fisher Scientific, Inc.) under the conditions: pre-denaturation at 95°C for 120 s and 40 cycles of denaturation at 95°C for 15s, and extending at 60°C for 60s. The 2^−ΔΔCT method was used for quantification [18 (link)]. U6 was used as the internal reference for miR-30e-5p and GAPDH was used as the internal reference for SP1. The primer sequences are shown in Table 1.Table 1.

Primer sequence

Name of primer	Sequences
miR-30e-5p-F	TGTAAACATCCTTGACTGGAAG
miR-30e-5p-R	GCGAGCACAGAATTAATACGAC
SP1-F	ATGAAATGA CAGCTGTGGT GA
SP1-R	TGAA AAAGGAGTTG GTGGCAA
GAPDH-F	CAAGCAACTGTCCCTGAG
GAPDH-R	TAGACAGAAGGTGGCACA
U6-F	ATTGGAACGATACAGAGAAG
U6-R	GGAACGCTTCACGAATTTG

Xia J., Song X., Meng J, & Lou D. (2022). Endothelial progenitor cells-derived exosomes transfer microRNA-30e-5p to regulate Erastin-induced ferroptosis in human umbilical vein endothelial cells via the specificity protein 1/adenosine monophosphate-activated protein kinase axis. Bioengineered, 13(2), 3566-3580.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following treatment, the cells were rinsed once with PBS on ice, then harvested in Buffer RLT with 2-Mercaptoethanol according to the RNAeasy mini kit (Qiagen). Cells were scraped in the buffer, then homogenized ten times with a 21-gauge syringe. Samples were then processed according to kit instructions. RNA concentration was measured with NanoDrop spectrophotometer using samples of RNA diluted in 10 mM Tris buffer. Synthesis of cDNA was performed using the Superscript IV kit (ThermoFisher) using a starting amount of 1 μg RNA. Custom 384-well, 8-port TaqMan Low Density Arrays (TLDA microfluidic cards) were supplied by ThermoFisher. The list of genes included on the card is provided in Supplementary Table S1. One sample was loaded per port at 100 ng converted RNA each, with TaqMan Universal Master Mix II, no UNG. Cards were loaded and sealed as instructed. Each well reaction volume was 1 μL. qPCR was run on the QuantStudio 7 instrument (ThermoFisher). The following temperature run was used: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s, 60 °C for 1 min. Ct values were calculated and normalized to the average of three reference genes, GAPDH, Ube2d2a, and Eif4a2, and vehicle control samples (ΔΔCt). Statistical analysis was performed using a one-way ANOVA with the Bonferroni post-test. All data are displayed as mean ± SEM.

O'Brien J.J., O'Callaghan J.P., Miller D.B., Chalgeri S., Wennogle L.P., Davis R.E., Snyder G.L, & Hendrick J.P. (2019). Inhibition of calcium-calmodulin-dependent phosphodiesterase (PDE1) suppresses inflammatory responses. Molecular and cellular neurosciences, 102, 103449.

+ Open protocol

+ Expand

Hippocampal Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue punches of the dorsal hippocampus were collected, total RNA was isolated and purified using the Quick-RNA Miniprep kit (Zymo research, Irvine, CA, USA, catalog no. R1054) according to the manufacturer’s protocol. RNA templates were reverse transcribed into cDNA with the Superscript IV kit (Thermo Scientific, Waltham, MA, USA, catalog no. 18091200) and random hexamer primers. cDNA was amplified on an Applied Biosystems ViiA7 Real-Time PCR System with POWRUP SYBR Green Master Mix (Thermo Scientific, Waltham, MA, USA, catalog no. 4368706). Primer sequences for Fkbp5, Nr3c1, Nr3c2 and Gapdh (housekeeper) can be found in the key resources table. Ct values were normalized using the established delta-delta Ct method (2–ΔΔCt) and normalized to Gapdh Cts.

Hartmann J., Bajaj T., Klengel C., Chatzinakos C., Ebert T., Dedic N., McCullough K.M., Lardenoije R., Joëls M., Meijer O.C., McCann K.E., Dudek S.M., Sarabdjitsingh R.A., Daskalakis N.P., Klengel T., Gassen N.C., Schmidt M.V, & Ressler K.J. (2021). Mineralocorticoid receptors dampen glucocorticoid receptor sensitivity to stress via regulation of FKBP5. Cell reports, 35(9), 109185.

+ Open protocol

+ Expand

Reverse Transcription and RNA Digestion Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse transcription was performed with SuperScript IV kit (Thermo Fisher Scientific 18091050). Different amounts of RNA were annealed with 1 μL 50 μM oligo(dT)₂₀ and 1 μL 10 mM dNTP for 5 min at 65°C and on ice immediately for 2 min. Then each sample was mixed with 4 μL 5× SSIV buffer, 1 μL 100 mM DTT, 1 μL ribonuclease inhibitor, and 1 μL SuperScript reverse transcriptase. One microliter of 100 μg/mL actinomycin D was also added to inhibit the minus-strand transfer step in the reverse transcription. H₂O was added up to a total of 20 μL volume. Samples were incubated for 90 min at 42°C; 10 cycles of 2 min at 50°C and 2 min at 42°C; then 5 min at 85°C, and 16°C to hold. After reverse transcription, 1 μL ExoI (NEB M0293S), 3 μL 10× reaction buffer, and 6 μL H₂O were added to digest oligo(dT)₂₀ primers for 30 min at 37°C. After inactivation of ExoI for 15 min at 80°C, 1 μL RNase A (Takara 2158) and 1 μL RNase H (Thermo Fisher Scientific 18091050) were added to digest RNA for 30 min at 37°C.

Zhang Y., Tang Y., Sun Z., Jia J., Fang Y., Wan X, & Fang D. (2023). Tn5 tagments and transposes oligos to single-stranded DNA for strand-specific RNA sequencing. Genome Research, 33(3), 412-426.

+ Open protocol

+ Expand

Reverse Transcription and qPCR for Photoreceptor Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA Reverse Transcription (RT). Total RNAs (250 ng) were treated with 2 units of DNAse1 (Roche, 4716728001) for 22 min at 37 °C, followed by thermic inactivation for 20 min at 70 °C. Samples were then reverse transcribed using a mix of oligo-dT and random hexamer primers with the SuperScript IV kit (ThermoFisher Scientific), following the manufacturer’s instructions.
Targeted tagged RT for putative eRNA and mRNA expression from photoreceptor gene loci. Total RNAs (1000 ng for putative eRNA/ 250 ng for mRNA) were treated with DNAse1 and reverse transcribed using SuperScript IV kit as described above. The strand specificity for qPCR was guaranteed by using tagged primers during the RT, as published in Craggs et al. [33 (link)] (Additional file 1: Table S1). These primers contain a 19–21 unique nucleotide ‘tag’ sequences unrelated to Mus musculus genome added to their 5′ end.
qPCR. Real-time qPCR reactions were performed on cDNAs (1/20 dilution for mRNA, 1/5 for putative eRNA) or ChIP samples (1/2 dilution) using QuantiTect SYBR Green PCR Master Mix (Qiagen), and gene and/or tag specific primers (Additional file 1: Table S1). Gene expression was normalized against Hprt or 36B4 (Rplp0).

Niewiadomska-Cimicka A., Hache A., Le Gras S., Keime C., Ye T., Eisenmann A., Harichane I., Roux M.J., Messaddeq N., Clérin E., Léveillard T, & Trottier Y. (2022). Polyglutamine-expanded ATXN7 alters a specific epigenetic signature underlying photoreceptor identity gene expression in SCA7 mouse retinopathy. Journal of Biomedical Science, 29, 107.

+ Open protocol

+ Expand

RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated using the RNeasy Mini Kit (Qiagen, no. 74104), followed by treatment with ezDNAse (Thermo Fisher Scientific, no. 18091150). First strand complementary DNA synthesis was performed using a SuperScript IV kit (Thermo Fisher Scientific, no. 18091050). Gene expression was determined by quantitative reverse transcription PCR on a Bio-Rad CFX384 Real-time PCR Detection System using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, no. 172-5272) with gene-specific primer sets. The cycle threshold values of a candidate gene were normalized to those of GAPDH, a reference gene, and the Δcycle threshold values were calculated. The results were plotted as fold changes relative to the WT sample.
PCR primers for PBRM1 were as follows: CGGGTGTGATGAACCAAGGA (forward) and
TTGGCTGCTGTATGACAGGG (reverse). PCR primers for GAPDH were as follows: GACAGTCAGCCGCATCTTCT (forward) and GCGCCCAATACGACCAAATC (reverse).

Menasche B.L., Davis E.M., Wang S., Ouyang Y., Li S., Yu H, & Shen J. (2020). PBRM1 and the glycosylphosphatidylinositol biosynthetic pathway promote tumor killing mediated by MHC-unrestricted cytotoxic lymphocytes. Science Advances, 6(48), eabc3243.

+ Open protocol

+ Expand

Quantitative SARS-CoV-2 RT-qPCR Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two-step quantitative reverse transcription PCR (RT-qPCR) was used to measure the viral loads of the clinical specimens. The RT-qPCR primers and thermal profile were originally developed by Roche Molecular Systems for their COBAS AMPLICOR and TaqMan HCV tests [26 , 27 (link)]. First-strand synthesis was first performed using the SuperScript IV kit, followed by amplification using the TaqMan Fast Advanced Master Mix reaction (Thermo Fisher Scientific). Each 20 μL reaction contained 10 μL master mix, 0.9 μL of 10 μM forward primer, 0.9 μL of 10 μM reverse primer, 0.25 μL of 10 μM probe, and 2.5 μL of cDNA. Amplification was conducted in 96 well plates on an Applied Biosystems QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) using the following thermal cycling profile: 95°C for 1:30 minutes, followed by 40 amplification cycles of 10 s at 95°C and 45 s at 58°C.
Viral loads of clinical samples were quantified by calculating copy numbers from a standard curve generated from quantified 5’ UTR cDNA using an established method [28 (link)]. Experimental data was processed with the Standard Curve Analysis Module of the QuantStudio Design and Analysis Software (Thermo Fisher Scientific). Separate standard curves were generated for each PCR-plate run, and all standard curve concentrations and unknown samples were run in triplicate.

Chia C.T., Bender A.T., Lillis L., Sullivan B.P., Martin C.D., Burke W., Landis C., Boyle D.S, & Posner J.D. (2022). Rapid detection of hepatitis C virus using recombinase polymerase amplification. PLOS ONE, 17(10), e0276582.

+ Open protocol

+ Expand

Quantitative Analysis of Cas9 and AP Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from OCT-embedded tissues using the RNeasy Fibrous Tissue kit (Qiagen). The cDNA was generated using the Super-script IV Kit (ThermoFisher Scientific) and quantified by the Qubit ssDNA assay kit (ThermoFisher Scientific) using the Qubit 3.0 Fluorometer (ThemoFisher Scientific). The Cas9 and AP transcripts were quantified by qPCR using the TaqMan Universal PCR master mix (ThermoFisher Scientific) and TaqMan custom-designed primers and probes (Supplemental Table 8). The qPCR was performed in the ABI 7900HT qPCR machine (ThermoFisher Scientific) using the SDS software (Version 2.4, ThermoFisher Scientific). The transcript copy number was determined by the cycle value from a quantitative reverse transcription PCR (RT-qPCR) reaction that was first converted to the raw copy number using a standard curve of the known amount of the cis-plasmid, and then divided by the total amount of cDNA (ng) used in the reaction.

Hakim C.H., Kumar S.R., Pérez-López D.O., Wasala N.B., Zhang D., Yue Y., Teixeira J., Pan X., Zhang K., Million E.D., Nelson C.E., Metzger S., Han J., Louderman J.A., Schmidt F., Feng F., Grimm D., Smith B.F., Yao G., Yang N.N., Gersbach C.A., Chen S.J., Herzog R.W, & Duan D. (2021). Cas9-specific immune responses compromise local and systemic AAV CRISPR therapy in multiple dystrophic canine models. Nature Communications, 12, 6769.

+ Open protocol

+ Expand

Quantifying Target Gene Expression from Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained from 50 oocytes using the RNAqueous Microkit (AM1931, Thermo Fisher Scientific, Waltham, MA, USA) and DNase I (18047019, Thermo Fisher Scientific) was used to inhibit contamination from genomic DNA. Reverse transcription was conducted using the SuperScript IV kit (12594100, Thermo Fisher Scientific). The RNA levels of target genes were quantified using the SsoFast EvaGreen Supermix (172-5200, Bio-Rad, Hercules, CA, USA). Real-time PCR was performed on QuantStudio 3 system (Thermo Fisher Scientific). The 2^−ΔΔCT method was used to calculate relative expression. The primers used for Real-time PCR are listed in Table 1.

Chen F., Luo A.F., Li M.G., Zheng L.X., Gu H., Zhou C.F., Zeng W., Molenaar A., Ren H.Y, & Bi Y.Z. (2024). 3-Methyl-4-nitrophenol Exposure Deteriorates Oocyte Maturation by Inducing Spindle Instability and Mitochondrial Dysfunction. International Journal of Molecular Sciences, 25(7), 3572.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA samples were reverse transcribed into cDNA using superscript IV kit (ThermoFisher Scientific, Waltham, MA) using random hexamer primers. Complementary DNA was amplified on a ViiA7 Real-Time PCR system (ThermoFisher Scientific, Waltham, MA) with POWRUP SYBR Green Master Mix (ThermoFisher Scientific, Waltham, MA). Primers for genes of interest and the housekeeping gene Actb are described in Supplementary Table 1. Specificity of the qPCR reaction was confirmed with melt curve analysis to ensure that only the expected PCR product was amplified. Duplicates were run for each reaction, and Ct values were normalized using the established delta-delta Ct method (2−∆∆Ct) and then normalized to Actb Cts.

Narendra S., Klengel C., Hamzeh B., Patel D., Otten J., Lardenoije R., Newman E.L., Miczek K.A., Klengel T., Ressler K.J, & Suh J. (2022). Genome-wide transcriptomics of the amygdala reveals similar oligodendrocyte-related responses to acute and chronic alcohol drinking in female mice. Translational Psychiatry, 12, 476.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!