Chromo4 real time pcr detector

Total RNA was isolated from treated Vero cells using RNAzol® RT (MRC Inc., USA). Reverse transcription was performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) and the viral genome was amplified with specific primers (MeVF: 5′ GAGGGTCAAACAGAGTCGAG 3′, MeVR: 5′ CGGTTGGAAGATGGGCAG 3′) that amplified a 95 nt fragment. The real-time PCR was carried out using SensiFAST™ SYBR® No-ROX Kit (BIOLINE, USA) and the Chromo4™ Real-Time PCR Detector (Bio-Rad, USA) with the following procedures: 95°C for 2 min, followed by 50 cycles of 95°C for 2 s, 60°C for 10 s, and 72°C for 20 s. The number of viral copies was calculated by using a standard curve. Serial 10-fold dilutions of a synthetic oligonucleotide encompassing the target measles gene were used to establish the standard curves.

Total RNA from skeletal muscles was extracted with the mini-RNA kit according to the manufacturer instructions (Qiagen). The reverse transcription reaction (RT) was performed using MMLV superscript reverse transcriptase (Invitrogen) and random hexamers (Operon) as described elsewhere [63 (link)]. The final RT reaction was diluted 10-fold in nuclease free water (Sigma). All Taqman qPCR reactions were performed as described previously [64 (link)] using the Chromo4 Real-Time PCR Detector (BioRad). Stable housekeeping genes for qPCR profiling of various skeletal muscles for HD mouse models were determined using the Primer Design geNorm Housekeeping Gene Selection Mouse Kit with PerfectProbe software. Estimation of mRNA copy number was determined in triplicate for each RNA sample by comparison to the geometric mean of three endogenous housekeeping genes (Primer Design) as described [65 (link)]. Primer and probe sets for genes of interest were purchased from Primer Design or ABI.

Quantitative real-time PCR (qRT-PCR) was performed to measure transcript levels. Total RNA samples and first-strand cDNA were prepared as previously described [39 (link)]. qRT-PCR was conducted in a Hard-Shell 96-well semi-skirted PCR plate (Bio-Rad, Hercules, CA, USA), using a Chromo4 Real-Time PCR Detector (Bio-Rad). Each well contained 5 μL 2 × SYBR Green RT-PCR Reaction Mix (Bio-Rad), 2 μL cDNA (12.5 ng/μL), and 15 pmol of each primer (Table 1). All the reactions were performed with 3 biological replicates, using 3 combined RNA samples extracted from independent fungal materials. A β-tubulin gene was included in the assays as an internal control for normalization (Table 1). All amplification curves were analyzed with a normalized reporter threshold of 0.25 to obtain the threshold cycle (Ct) values. The comparative ΔΔCt method was used to evaluate the relative quantities of each amplified product in the samples. Fold changes were calculated as 2^–ΔΔCt _ENREF_53 [40 (link)].

RNA was extracted from ten worms for each RNAi population using TRIzol (Invitrogen, Carlsbad, CA, USA) then purified using an RNeasy Mini Kit (QIAGEN, Germantown, MD, USA) including a DNase treatment. cDNA was synthesized from each RNA pool using the SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s protocol and priming with random hexamers. Primers for qPCR were designed using Primer3 [46 (link)] and are listed in Table 2.
DjGAPDH and SmedGAPDH were used as housekeeping genes for their respective species. qPCR was performed on an MJ Research PTC-200 thermocycler equipped with a Chromo4 Real-Time PCR Detector (Bio-Rad Laboratories, Hercules, CA, USA), using PerfeCTa® SYBR® Green FastMix® (Quantabio, Beverly, MA, USA). Technical triplicates were run for all reactions within an experiment, and two biological replicates were performed. To analyze primer efficiency, standard curves were obtained using a 1:1:1:1 mix of all cDNA pools for each species, serially diluted. The efficiency for each primer pair was found to be between 87–116%. Analysis of relative expression for the genes targeted by RNAi was performed using the ΔΔCt method, where reported values are the mean of all replicates.

To assay the relative expressions of genes, real-time RT-PCR analysis was performed with the RNA samples isolated from 2-week-old seedlings after treatment with salt stress. Total RNA was extracted with Trizol reagent (Invitrogen, USA). All samples were made up to 10 µl in volume. A SYBR Green Real-time PCR Master Mix (Takara, Japan) and a Chromo 4 Real-time PCR detector (Bio-Rad, USA) were used for real-time RT-PCR. The data are presented after normalizing to the reference gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and three biological replicates under similar conditions were performed for each experiment. The specific primers for these genes are listed in Supplementary Table S5.

Total RNA from whole hearts was extracted with the mini-RNA kit according to manufacturer's instructions (Qiagen). The reverse transcription reaction (RT) was performed using MMLV superscript reverse transcriptase (Invitrogen) and random hexamers (Operon) as described elsewhere [47] (link). The final RT reaction was diluted 10-fold in nuclease free water (Sigma). All Taqman qPCR reactions were performed as described previously [48] (link) using the Chromo4 Real-Time PCR Detector (BioRad). Estimation of mRNA copy number was determined in triplicate for each RNA sample by comparison to the geometric mean of three endogenous housekeeping genes (Primer Design) as described [49] (link). Primer and probe sets for genes of interest were purchased from Primer Design or ABI.