Ap conjugated dig antibody

Manufactured by Roche

Sourced in Switzerland, United States

The AP-conjugated DIG-Antibody is a laboratory reagent designed for use in various immunoassay techniques. It consists of an alkaline phosphatase (AP) enzyme conjugated to an antibody that specifically binds to digoxigenin (DIG), a small hapten molecule. This product can be used to detect and quantify target analytes labeled with DIG in research and diagnostic applications.

Automatically generated - may contain errors

Lab products found in correlation

Pcr dig probe synthesis kit, by Roche (3 mentions) Cdp star, by Roche (2 mentions) Dig oligonucleotide tailing kit, by Roche (1 mentions) Cspd solution, by Roche (1 mentions) Xhoi restriction enzyme, by New England Biolabs (1 mentions) Positively charged nylon membrane, by Roche (1 mentions) Hybond n membrane, by GE Healthcare (1 mentions) Maxwell rsc cultured cells dna kit, by Promega (1 mentions) Bglii, by New England Biolabs (1 mentions) Rpn303b, by Cytiva (1 mentions) Cdp star, by Merck Group (1 mentions)

5 protocols using ap conjugated dig antibody

Northern Blot Analysis of osa-miR171

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze osa‐mature‐microRNA171a‐f (osa‐miR171) transcripts, total RNA was extracted from the indicated samples and 15 μg was separated on a 12.5% urea‐polyacrylamide gel and electro‐transferred to a Hybond N+ membrane (GE Healthare). The miR171 probe was generated by labeling oligonucleotides complementary to the miR171 sequence (5′‐GATATTGGCGCGGCTCAATCA‐3′) using a DIG oligonucleotide tailing kit (Roche). U6 snRNA (5′‐ TTGCGTGTCATCCTTGCGCAGG‐3′) was used as equal loading indicator of RNA samples. An AP‐conjugated DIG antibody (Roche) was used for probe detection. Signals were visualized by treatment with an CSPD solution (Roche) and exposure to X‐ray film.

Um T., Choi J., Park T., Chung P.J., Jung S.E., Shim J.S., Kim Y.S., Choi I., Park S.C., Oh S., Seo J.S, & Kim J. (2022). Rice microRNA171f/SCL6 module enhances drought tolerance by regulation of flavonoid biosynthesis genes. Plant Direct, 6(1), e374.

+ Open protocol

+ Expand

Southern Blot Analysis of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

5μg genomic DNA was digested with XhoI restriction enzyme (New England Biolabs, USA) overnight and then electrophoresed on a 0.8% agarose gel for 3h at 180V followed by transfer to a positively charged nylon membrane (Roche Diagnostics, Switzerland) by capillary siphon blotting overnight. DNA molecular weight marker III, digoxigenin (DIG) -labeled DNA (Roche Diagnostics, Switzerland) and lambda DNA Hind III (TaKaRa, Japan) were used as molecular weight markers. The blots were then blocked and then hybridized with DIG-dUTP labeled probes overnight at 42°C. This was followed by incubation with AP-conjugated DIGantibody (Roche Diagnostics, Switzerland) for 30 min. After thorough washing, the signals were detected using CDP-Star (Roche Diagnostics, Switzerland) as a substrate for chemiluminescence. Probes were generated by PCR DIG Probe Synthesis Kit (Roche Diagnostics, Switzerland) using the primer pairs, 5′-GCCGAGAAAGTATCCATCA-3′/ 5′-CAGAGTCCCGCTCAGAAG-3′.

Liu B., Chen F., Wu Y., Wang X., Feng M., Li Z., Zhou M., Wang Y., Wu L., Liu X, & Liang D. (2017). Enhanced tumor growth inhibition by mesenchymal stem cells derived from iPSCs with targeted integration of interleukin24 into rDNA loci. Oncotarget, 8(25), 40791-40803.

+ Open protocol

+ Expand

Southern Blot Analysis of Transgene Integration

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 5′ arm probe and the GFP probe were PCR amplified from the AAVS1-LSL-GFP donor vector with the PCR DIG Probe Synthesis Kit (Roche). Primer sets for 5′ arm probe were: ACAGGTACCATGTGGGGTTC and CTTGCCTCACCTGGCGATAT; and primer sets for GFP probe were: AGGTTCCGTCTTCCTCCACT and GTCCAGGCAAAGAAAGCAAG. Genomic DNA (5–10 μg) was digested overnight with EcoRI for the 5′ arm probe and BsaI for the GFP probe, and subjected to electrophoresis. Gels were denatured, neutralized, and transferred overnight by capillarity on Hybond-N membranes (GE Healthcare) using 10× SSC transfer buffer. For membrane hybridization, 5 μL of denatured DIG-labeled probe was mixed with 20 mL hybridization buffer. Hybridization was carried out overnight at 65°C. Probes were detected by an AP-conjugated DIG-Antibody (Roche) using CDP-Star (Roche) as a substrate for chemiluminescence.

Chen Z., Ren X., Xu X., Zhang X., Hui Y., Liu Z., Shi L., Fang Y., Ma L., Liu Y., Terheyden-Keighley D., Liu L, & Zhang X. (2018). Genetic Engineering of Human Embryonic Stem Cells for Precise Cell Fate Tracing during Human Lineage Development. Stem Cell Reports, 11(5), 1257-1271.

+ Open protocol

+ Expand

In Situ Hybridization of Tissue Sections

Check if the same lab product or an alternative is used in the 5 most similar protocols

Kidneys, livers, and adrenals were removed and immediately fixed in 4% PFA at 4°C for 24 hours, and embedded in paraffin. ISH was performed on 7-μm-thick sections as we previously described (Medrano et al., 2014 (link)). Hybridization was conducted at 50°C for 18 hours using 500 ng/mL digoxigenin (DIG)-labeled riboprobes as detailed above (section 2.2.) in hybridization solution. Sites of hybridization were detected using alkaline phosphatase (AP)-conjugated DIG antibody (Roche Diagnostics Corp.; Indianapolis, IN, USA) at a 1:4000 dilution followed by BM Purple AP substrate color development (Roche; Basel, Switzerland). Sections were post-fixed in 4% PFA/0.2% glutaraldehyde and counterstained with hematoxylin and eosin (H&E) for better visualization. Negative controls were performed by omitting the probe in the hybridization step and with the use of a sense riboprobe that was not complementary to the sequence of interest.

Hoy J., Nishimura H., Mehalic T., Yaoita E., Paxton R., Gomez R.A, & Sequeira-Lopez M.L. (2020). Ontogeny of renin gene expression in the chicken, Gallus gallus. General and comparative endocrinology, 296, 113533.

+ Open protocol

+ Expand

Southern Blot Analysis of Genomic DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA from each cell line was isolated with Maxwell® RSC Cultured Cells DNA Kit (Promega). 6 μg of DNA from each clone was digested with SphI (for 5′ probe) or BglII (for 3′ probe) (New England Biolabs), separated on a 1% agarose gel and transferred to a nylon membrane (RPN303B, Amersham). Membranes were hybridized with DIG-dUTP labeled probes. Probes were detected by an AP-conjugated DIG-Antibody (Roche Diagnostics) using CDP-Star (Sigma-Aldrich) as a substrate for chemiluminescence. Probes were synthesized by PCR using the PCR DIG Probe Synthesis Kit (Roche Diagnostics). 5′ probe was generated using plasmidic DNA and 3′ probe using genomic DNA as a templates. Primers used for probes are detailed in Table 2.

Castaño J., Bueno C., Jiménez-Delgado S., Roca-Ho H., Fraga M.F., Fernandez A.F., Nakanishi M., Torres-Ruiz R., Rodríguez-Perales S, & Menéndez P. (2017). Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the “safe harbor” AAVS1 locus. Stem Cell Research, 21, 137-140.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!