Knockout of FAP in NK92 cells was accomplished by CRISPR using nucleofection, as previously described60 . 2μL of CAS9 RNP (Horizon Discovery, cat#CAS12205) and 2μL FAP sgRNA (Horizon Discovery, cat#SQ-003829–01-0002) were incubated together for 15 minutes at room temperature. The sgRNA complexes were then added to 1×106 NK92 cells resuspended in 16uL of P3 nucleofection buffer (Lonza). The nucleofection mixture was transferred to a 16-well strip for nucleofection in the Lonza 4D Nucleofector using the pulse code CM-138. The 20μL nucleofection mixture was then added directly to 1mL of pre-warmed NK media. This process was repeated an additional time and cells were used 72 hours later.
P3 nucleofection buffer
Manufactured by Lonza
The P3 nucleofection buffer is a cell-specific buffer designed for use with the Lonza Nucleofector™ technology. It is formulated to facilitate the delivery of nucleic acids, such as plasmids, mRNA, or small interfering RNA, into a variety of cell types through electroporation. The buffer helps to maintain cell viability and transfection efficiency during the nucleofection process.
Automatically generated - may contain errors
Lab products found in correlation
B2m targeting sgrna, by Synthego (2 mentions)
P3 nucleofection buffer, by Synthego (2 mentions)
4d nucleofector, by Lonza (1 mentions)
4d strip nucleocuvette, by Lonza (1 mentions)
X vivo 15, by Lonza (1 mentions)
Lymphoone t cell expansion medium, by Takara Bio (1 mentions)
Anti pe microbeads, by Miltenyi Biotec (1 mentions)
4d nucleofector x kit, by Lonza (1 mentions)
Human serum, by Gemini Bio (1 mentions)
X vivo media, by Lonza (1 mentions)
6 protocols using p3 nucleofection buffer
1
CRISPR-Mediated FAP Knockout in NK92 Cells
2
Optimized Electroporation of Mouse Microglial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Electroporation was performed using the protocol for HMC3 and a set of BV-2-specific pulse codes listed in Table S3
3
Cas9 RNP Synthesis for CD34+ HSPC Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cas9 RNP synthesis was carried out as previously described (DeWitt et al., 2016 ). Briefly, 75pmol of Cas9-NLS (UC Berkeley, Berkeley, CA) was mixed slowly into Cas9 buffer (20mM HEPES (pH 7.5), 150mM KCl, 1mM MgCl2, 10% glycerol and 1mM TCEP) containing 75pmol of synthetic sgRNA targeting the HBB locus (Synthego). The resulting 7.5ul mixture was incubated for 15minutes to allow RNP formation. 2x10−5 CD34+ HSPCs were harvested, washed once with PBS, and resuspended in 20ul of P3 nucleofection buffer (Lonza, Basel, Switzerland). 7.5ul of RNP mixture and 20ul of cell suspension were combined and added into a Lonza 4d strip nucleocuvette and were electroporated with program ER-100. 200ul pre-warmed media was added to each nucleocuvette and electroporated cells were transferred to culture dishes. Editing outcomes were measured 1-5 days post-electroporation by Next Generation Amplicon Sequencing.
4
CRISPR-Cas9 Editing of Primary T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen PBMCs were thawed and activated. Transductions were performed 24 hours post-activation using lentivirus (Alstem) at MOI 10. 24 hours post-transduction, primary T cells were transfected with CRISPR-Cas9:sgRNA complexes. Briefly, cells were collected and washed with PBS before resuspending in supplemented P3 nucleofection buffer (Lonza). A quantity of 20 pmol of Cas9 (Synthego) was combined with 130 pmol B2M-targeting sgRNA (Synthego) and incubated in P3 nucleofection buffer before addition to cells. Twenty microliters of the cell and ribonucleoprotein (RNP) mixture was transferred to a 16-well Nucleocuvette Strip and electroporated with the 4D nucleofector using the stimulated T cell program (EO-115). The cells were recovered in 100 µL of prewarmed media, X-VIVO 15 (Lonza) supplemented with 5% HIA human AB serum and 300 IU/mL IL-2. PBMCs were cultured and expanded in LymphoONE Tcell Expansion Medium (Takara Bio) supplemented with 1% HIA human AB serum and 300 IU/mL IL-2 for 6 days. Post expansion, positively transduced primary T cells were enriched using anti-PE microbeads (Miltenyi) according to manufacturer’s instructions against Protein L-biotin:streptavidin-PE using LS column. Cytotoxicity of B2M KO primary T cells was then assessed exactly as described previously.
5
CRISPR-Mediated Knockout of CD55 in CD34+ Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two sgRNAs targeting human CD55 exons were designed using the Broad Institute’s GPP sgRNA design portal and synthesized as chemically modified sgRNAs by Synthego. CD55-Cr1 is predicted to recognize a sequence in exon 1 of CD55 and has the sequence: GGGCCCCUACUCACCCCACA . CD55-Cr8 is predicted to recognize a sequence in exon two and has the sequence: CUGGGCAUUAGGUACAUCUG . Experiments using dual sgRNAs typically produce large deletions between the Cas9 binding sites as well as smaller indels, leading to frameshift mutations (Mandal et al., 2014 (link)). Ribonucleoprotein (RNP) complexes containing one or both sgRNAs were prepared by slowly adding 300 pmol of each sgRNA to 150 pmol Cas9 protein in a 10 µl final volume with nuclease-free water and incubating at room temperature for 10 min. On day 2 after thawing CD34 + cells, the RNP complexes were added to 1 × 105 cells in 40 µl of P3 nucleofection buffer from the 4D-Nucleofector X kit (Lonza). Half of the mixture was loaded to each well of a 16-well nucleofection cassette and nucleofected using the using E0-100 program with the 4D-Nucleofector Lonza Amaxa. After nucleofection, cells were transferred to 6 ml fresh cPIMDM and incubated at 37°C in 5% CO2 in air.
6
CRISPR-Cas9 Mediated B2M Knockout in Primary T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
24-48 hours post-transduction primary T cells were transfected with CRISPR-Cas9:sgRNA complexes. Briefly, cells were collected and washes with PBS before resuspending in supplemented P3 nucleofection buffer (Lonza). A quantity of 20 pmol of Cas9 (Synthego) was combined with 130 pmol B2M-targeting sgRNA (IDT) and incubated in P3 nucleofection buffer before addition to cells. Twenty microliters of the cell and ribonucleoprotein (RNP) mixture was transferred to a 16-well Nucleocuvette Strip and electroporated with the 4D nucleofector using the stimulated T cell program (EO-115). The cells were recovered and expanded in X-vivo media (Lonza) supplemented with 1% human serum (GeminiBio) and IL-2 (300 IU/ml). B2M KO was checked by flow cytometry after staining with anti-HLA-I antibody (W6/32).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!