The largest database of trusted experimental protocols

Isogen 2 isolation reagent

Manufactured by Nippon Gene
Sourced in Japan

ISOGEN II Isolation Reagent is a reagent used for the isolation of total RNA from various biological samples. It is a solution containing phenol and guanidinium thiocyanate for the effective extraction and purification of RNA.

Automatically generated - may contain errors

3 protocols using isogen 2 isolation reagent

1

Rapid Mouse Organ RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the resected mouse organs using ISOGEN II Isolation Reagent (Nippon Gene, Tokyo, Japan). Reverse transcription was then performed using ReverTraAce qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). A real-time polymerase chain reaction (PCR) was performed using FastStart SYBR® Green Master Mix (Roche Applied Science, Penzberg, Germany) with specific primers on a StepOnePlus™ Realtime PCR system (Applied Biosystems, Foster City, CA, USA). The primers used are shown in Table 2.
+ Open protocol
+ Expand
2

Gene Expression Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
ISOGEN II Isolation Reagent was used to extract total RNA from all cell types prepared in this study (Nippon Gene, Tokyo). Reverse transcription was then performed using ReverTraAce qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). Real-time polymerase chain reaction (PCR) was performed using FastStart SYBR® Green Master Mix (Roche Applied Science, Penzberg, Germany) with specific primers on a StepOnePlus™ Real-time PCR system (Applied Biosystems, Foster, CA).
The primers used were as follows: ACTB (forward: 5′-ctggaacggtgaaggtgaca-3′; reverse: 5′-aagggacttcctgtaacaatgca-3′); REIC/DKK3 (forward: 5′-aactgatggaggacacgcag-3′; reverse: 5′-gctgggaggtaagtttgcca-3′); CD274 (PD-L1) (forward: 5′-ggcatccaagatacaaactcaa-3′; reverse: 5′-cagaagttccaatgctggatta-3′); C5AR (forward: 5′-ggagggaccttcgatcctc-3′; reverse: 5′-ggggtggtataattgaaggagtt-3′); CXCR2 (forward: 5′-gaggcacagtgaagacatcg-3′; reverse: 5′-gctgggcttttcacctgtag-3′); CXCR6 (forward: 5′-ggggatgacatgtgactcctat-3′; reverse: 5′-cgtgctcacctcttcaacct-3′); ACKR3 (CXCR7) (forward: 5′-cagttgttgcaaagtgctcag-3′; reverse: 5′-cgggcaatcaaatgacct-3′); and CMTM6 (forward: 5′-ggacttcagctgagattgctg-3′; reverse: 5′-ccctagtggtattttcaggttttc-3′).
+ Open protocol
+ Expand
3

Gene Expression Analysis in Cultured Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cultured cells were washed with phosphate-buffered saline, and total RNA was extracted using ISOGEN II Isolation Reagent (Nippon Gene, Tokyo, Japan). Then reverse transcription was performed using ReverTraAce qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). Real-time PCR was performed using FastStart SYBR Green Master (Roche Applied Science, Penzberg, Upper Bavaria, Germany) with specific primers on a LightCycler 480 system II (Roche Applied Science): S100A11, forward primer: tctccaagacagagttcctaagc; reverse primer: atcatgcggtcaaggacac; TBP (internal cont.), forward primer: gaacatcatggatcagaacaaca; reverse primer: atagggattccgggagtcat; Rps6kb1, forward primer: taaagggggctatggaaagg; reverse primer: ttaagcaccttcatggcaaa; Rps6kb2, forward primer: cctggagtgcctcagtgg; reverse primer: atggcccagggctagtgt; Tbp (internal cont.), forward primer: gggagaatcatggaccagaa; reverse primer: gatgggaattccaggagtca.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!