Geneamp pcr system 2700 thermal cycler

Manufactured by Thermo Fisher Scientific

Sourced in United States

The GeneAmp PCR System 2700 is a thermal cycler designed for performing polymerase chain reaction (PCR) experiments. It has a temperature range of 4°C to 99.9°C and can accommodate 96-well sample blocks. The device is used to precisely control the temperature and cycling conditions required for DNA amplification.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Thermal cycler (242 citations) GeneAmp PCR System 2700 (130 citations) GeneAmp PCR System (39 citations) PCR thermal cycler (22 citations) GeneAmp 2700 (7 citations) GeneAmp 2700 Thermal Cycler (4 citations) GeneAmp PCR Systems 2700 (4 citations) PCR System 2700 (3 citations) Thermal cycler system (3 citations) 2700 Thermal cycler (2 citations)

12 protocols using geneamp pcr system 2700 thermal cycler

Identification and Characterization of Bacterial Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Identification of selected isolates was done by testing their morphological and biochemical characteristics. Taxonomic determination of isolates was done initially by 16S rRNA gene sequencing [56 (link)], and confirmed by genome sequencing. Platinum Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, Waltham, MA, USA) was used to amplify the gene for 16S rRNA using a GeneAmp PCR System 2700 thermal cycler (Applied Biosystems, Foster City, CA, USA) under the conditions listed in S1A Table. PCR products were checked on a 1% agarose gel (at a constant voltage of 80 V) and purified using a Thermo Scientific PCR Purification Kit (Thermo Scientific, Lithuania) according to the manufacturer’s protocol and sequenced and identified by using BLAST.
Pulse field gel electrophoresis (PFGE) was performed for isolates comparison and for strain determination, as described previously [57 (link)] using NotI macro-restriction polymorphism.

Miljkovic M., Jovanovic S., O’Connor P.M., Mirkovic N., Jovcic B., Filipic B., Dinic M., Studholme D.J., Fira D., Cotter P.D, & Kojic M. (2019). Brevibacillus laterosporus strains BGSP7, BGSP9 and BGSP11 isolated from silage produce broad spectrum multi-antimicrobials. PLoS ONE, 14(5), e0216773.

+ Open protocol

+ Expand

Genotyping of CYP4F2 Polymorphisms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sequences containing the CYP4F2 W12G and V433M polymorphisms were amplified by PCR. The primer sequences for PCR amplification were 5′-CAGGAAGTCCATCCATCCTGA-3′ for W12G-F;5′-GGCCTTTCTGGACTTTACCTCT-3′ for W12G-R; 5′-CTCTAGGAGCCTTGGAATGGA-3′ for V433M-F and 5′- CTCCTGACTGCTCCCTTCTCTC-3′for V433M-R. PCR reactions were set up in a 25 ul volume using the HotStar Taq Master Mix Kit (Qiagen, CA, USA) with 10 pmol of each primer and 10 ng DNA. DNA amplification was performed in the GeneAmp PCR System 2700 thermal cycler (Applied Biosystems, CA, USA) with the following program: 10 min at 95°C for 1 cycle, followed by 35 cycles of 95°C for 10 s, 58°C for 20 s and 72°C for 40 s and 1 final extension cycle of 72°C for 7 min. PCR products were then purified using the ExoSAP-IT reagent (Affymetrix, CA, USA) according to the manufacturer's instructions. The purified PCR products were directly sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) according to the manufacturer's instructions, and the sequencing results and genotypes were read and summarized using the Mutation Surveyor DNA Variant Analysis Software (Softgenetics, PA, USA).

Athinarayanan S., Wei R., Zhang M., Bai S., Traber M.G., Yates K., Cummings O.W., Molleston J., Liu W, & Chalasani N. (2014). Genetic Polymorphism of Cytochrome P450 4F2, Vitamin E Level and Histological Response in Adults and Children with Nonalcoholic Fatty Liver Disease Who Participated in PIVENS and TONIC Clinical Trials. PLoS ONE, 9(4), e95366.

+ Open protocol

+ Expand

SNP-based Markers for Sunflower Genome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

SNP-based markers were developed for the detection of the SNP G to C at position 173,473,513 of the sunflower genome sequence (https://www.heliagene.org/HanXRQ-SUNRISE/, [15 (link)]). This SNP was found in the sequence of the PPR621, a pentatricopeptide repeat candidate gene. Created SNP-based markers, PPR621.5M and PPR621.5R, consist of allele-specific primers, two forward and one common reverse primer (Supplementary Table S6). In addition, a second SNP G to A was present in the forward primer sequence, which was detected at the position 173,473,493 of the sunflower genome (Supplementary Table S2). Primers were designed by use of program Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/). PCR mixture (15 µL) used for amplification was the same as with the PAMSA marker (except that in this reaction only two primers were added to the mixture). Amplification was performed in Applied Biosystems GeneAmp^® PCR System 2700 Thermal Cycler under the following conditions: 2 min denaturation at 94 °С, followed by 30 cycles; 30 sec denaturation at 94 °С, 30 sec annealing at 62 °С, 1 min polymerization at 72 °С; followed by a final 4 min period of elongation at 72 °С. The amplification products were separated on ethidium bromide stained 2% agarose gels (Agarose NEEO ultra-quality Roth^®, Karlsruhe, Germany) at 120 V for 60 min.

Horn R., Radanovic A., Fuhrmann L., Sprycha Y., Hamrit S., Jockovic M., Miladinovic D, & Jansen C. (2019). Development and Validation of Markers for the Fertility Restorer Gene Rf1 in Sunflower. International Journal of Molecular Sciences, 20(6), 1260.

+ Open protocol

+ Expand

Molecular Detection of E. coli O157

Check if the same lab product or an alternative is used in the 5 most similar protocols

All presumptive E. coli O157 strains were tested serologically using the E. coli O157 latex agglutination test E. COLIPRO^TM O157 KIT (Hardy diagnostics, USA) according to manufacturer’s instructions. Seropositive strains were further confirmed by the detection of E. coli rfb_EO157 gene using PCR. Only PCR positive strains for rfb_EO157 gene were retained for analysis. Total DNA was extracted from pelleted cells of freshly prepared broth cultures of E. coli O157 isolates using the QIAamp DNA Mini Kit following the manufacturer’s instructions (QIAGEN, Germany). The eluted DNA was held at -20°C until used for PCR analyses. Each reaction mixture was made up of template DNA (5 μL), 12.5 μL of 2X master mix (TopTaq™ Master Mix, Qiagen, Hilden, USA) and 0.5 μL of each primer from a working solution of 20 μM (final concentration of 0.4 μM), and nuclease-free PCR water to make up 25 μL total individual reaction volume. The amplification of DNA was carried out in a GeneAmp PCR system 2700 thermal cycler (Applied Biosystems, USA). PCR targeting the rfb_EO157 gene was optimized at 95°C for 15 min; 30 cycles of 94°C for 30s, 56°C for 1 min and 72°C for 1 min; and a final extension of 72°C for 10 min. The primer set used were O157f (CGGACATCCATGTGATATGG) and O157r (TTGCCTATGTACAGCTAATCC) as previously described [18 (link)].

Akomoneh E.A., Esemu S.N., Jerome Kfusi A., Ndip R.N, & Ndip L.M. (2020). Prevalence and virulence gene profiles of Escherichia coli O157 from cattle slaughtered in Buea, Cameroon. PLoS ONE, 15(12), e0235583.

+ Open protocol

+ Expand

TMPRSS2-ERG Fusion Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from LNCaP and VCaP cells using TRIzoL (Thermo Fisher Scientific). RNA was reversely transcribed to cDNA via iScriptTM Reverse Transcription Supermix (Bio-Rad Laboratories). After quantification by NanoVue Plus spectrophotometer (GE Healthcare), 500 ng cDNA was utilized as a template for amplification of TMPRSS2-ERG fusion using Hot Start Taq 2X Master Mix (New England Biolabs) and GeneAmp PCR System 2700 thermal cycler (Applied Biosystems). The forward and reverse PCR primers for T1/E4 fusion included 5’-TAGGCGCGAGCTAAGCAGGAG-3’ and 5’-CCATAT TCTTTCACCGCCCACTCC-3’ (Integrated DNA Technologies). ERG isoform-6 primers were 5'-GGTACGAAAACACCCCTGTG-3' (forward) and 5'-CCAAATCAACAGAGGCAGAA-3' (reverse); the total ERG primers were 5'-AACGAGCGCAGAGTTATCGT-3' (forward) and 5'-GTGAGCCTCTGGAAGTCGTC-3' (reverse). The final volume was 25 μl, and an initial denaturation step of 95 °C for 5 min was followed by 40 cycles of 95 °C for 30 s, 59 °C for 30 s, 72 °C for 30 s, and one cycle at 72 °C for 5 min. T1/E4 fusion, isoform-6, and total ERG cDNA were detected by 2% agarose gel electrophoresis (supplemental Fig. S1).

Fu Z., Rais Y., Bismar T.A., Hyndman M.E., Le X.C, & Drabovich A.P. (2021). Mapping Isoform Abundance and Interactome of the Endogenous TMPRSS2-ERG Fusion Protein by Orthogonal Immunoprecipitation–Mass Spectrometry Assays. Molecular & Cellular Proteomics : MCP, 20, 100075.

+ Open protocol

+ Expand

MLPA Analysis for α-Thalassemia

Check if the same lab product or an alternative is used in the 5 most similar protocols

MLPA analysis using SALSA MLPA probemix 140 HBA (MRC-Holland, Amsterdam, Netherlands) was carried out to exclude the coinheritance of α-thalassemia. Ligation and amplification reactions were performed on a GeneAmp® PCR System 2700 thermal cycler (Applied Biosystems, Foster City, CA, USA). MLPA products were separated by ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and quantified as already described [9 (link)].

Pirastru M., Mereu P., Nguyen C.Q., Nguyen N.V., Nguyen T.D, & Manca L. (2017). A Novel -72 (T→A) β-Promoter Mutation Causing Slightly Elevated HbA2 in a Vietnamese Heterozygote. BioMed Research International, 2017, 4537409.

+ Open protocol

+ Expand

miRNA cDNA Synthesis Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized using the miRCURY LNA Universal RT microRNA PCR, Polyadenylation and cDNA synthesis kit II (Exiqon, BioNova, Madrid, Spain). Briefly, 2μL of miRNA sample was mixed with 1μL Reverse Transcriptase enzyme, 2μL Reaction buffer and 5μL H₂O. Then, GeneAmp PCR System 2700 Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, Massachusetts, USA) was employed for the sample incubation. Using the thermocycler program, the miRNAs samples were reversing transcript for 60min at 42°C, the Reverse Transcriptase was inactivated for 5min at 95°C and the samples containing cDNA were maintained at 4°C and finally stored at -20°C.

Esplugas R., Arenas M., Serra N., Bellés M., Bonet M., Gascón M., Vallvé J.C, & Linares V. (2019). Effect of radiotherapy on the expression of cardiovascular disease-related miRNA-146a, -155, -221 and -222 in blood of women with breast cancer. PLoS ONE, 14(5), e0217443.

+ Open protocol

+ Expand

Semi-Quantitative PCR Analysis of Larval RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from wandering third-instar larvae with the Trizol (EuroGold Trifast, EMR527100 Vetroscientifica, Rome, Italy) according to the manufacturer’s instruction. RNA was retrotranscribed with the RETROscript kit (AM1710; Fisher Scientfic, Pittsburgh, PA, USA), according to the manufacturer’s instruction. The reverse transcription was performed on a GeneAmp PCR System 2700 Thermal Cycler (Applied Biosystems, Foster City, CA, USA), according to the following PCR conditions: 25 °C for 10 s, 42 °C for 15 s, 85 °C for 5 s, 4 °C to ∞. Semi-quantitative PCR (sqPCR) reactions were conducted by using SapphireAmp Fast PCR Master Mix (Takara-bio, RR350B Saint-Germain-en-Laye, France) according to the manufacturer’s instruction. Gene-specific primers for sqPCR amplification were designed using Primer designing tool—NCBI—NIH (Table S1). Thermal cycling conditions were: 94 °C for 1 min; 30 cycles of 98 °C for 5 s, 55 °C for 10 s, and 72 °C for 10 s. The sqPCR amplification products were analyzed by electrophoresis in 1.5% agarose gel. Gene expression level was normalized to RPL32 ribosomal protein and quantified by ImageJ software. Values were calculated from three independent experiments.

Prozzillo Y., Cuticone S., Ferreri D., Fattorini G., Messina G, & Dimitri P. (2021). In Vivo Silencing of Genes Coding for dTip60 Chromatin Remodeling Complex Subunits Affects Polytene Chromosome Organization and Proper Development in Drosophila melanogaster. International Journal of Molecular Sciences, 22(9), 4525.

+ Open protocol

+ Expand

Genetic Diversity Assessment of V. pycnotelma

Check if the same lab product or an alternative is used in the 5 most similar protocols

In 2012 and 2013, leaf samples from 131 adult individuals were collected from sites same as those from where the herbarium specimens had been collected (Figs. 1c and2). The samples were used to estimate the genetic diversity among the extant populations (Table 2). At all sites, we comprehensively collected samples from each entire patch. Because V. pycnotelma at Site e was locally extinct, we collected leaf samples from a neighbouring population located one kilometre away. The number of individuals was counted at each site.
Genomic DNA was extracted using a modified cetyltrimethylammonium bromide method (Milligan 1992) . The genotypes of each individual, including wild populations and specimens' seedlings, were characterized at nine microsatellite loci. Seven of the nine loci were characterized by Nakahama et al. (2012) : Vpy002, Vpy006, Vpy012, Vpy013, Vpy16, Vpy018 andVpy022 loci were carried out using a GeneAmp PCR System 2700 thermal cycler (Applied Biosystems, Tokyo, Japan) using the following conditions: initial denaturation at 95°C for 15 min, followed by 25 cycles of 30 s at 94°C, 1.5 min at 57°C and 1 min at 72°C, and a final extension for 30 min at 60°C. The PCR product size was measured using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems) and GeneMapper ver. 4.1 (Applied Biosystems).

Nakahama N., Hirasawa Y., Minato T., Hasegawa M., Isagi Y, & Shiga T. (2015). Recovery of genetic diversity in threatened plants through use of germinated seeds from herbarium specimens. Plant Ecol., 216(12).

+ Open protocol

+ Expand

ITS Sequencing of Korean Diplazium Fern

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total genomic DNA samples were extracted from the leaves of two dried specimen (Voucher Nos. KIMJH20121 and KIMJH20122) with a MG Plant Genomic DNA Extraction SV Miniprep kit (MGmed, Seoul, Korea) according to the manufacturer's instruction. We used PCR amplification for the internal transcribed spacer (ITS) of nuclear ribosomal DNA, and we chose primers designed in previous studies (White et al., 1990; Jin et al., 2019) . We conducted PCR with a GeneAmp PCR System 2700 Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The PCR reaction mixture included the MG 2× Taq MasterMix with a dye (MGmed), 10 ng of DNA, 0.3 µM primers, and distilled water. Conditions included initial denaturation at 94 o C for 3 min followed by 30 cycles each at 94 o C for 30 s, 53 o C for 45 s, and 72 o C for 1 min. The total volume was 50 µL. The PCR products were visualized on 2% agarose gels, which were then processed with a MG PCR purification kit (MGmed). Sequencing was conducted with MACROGEN (Macrogen Inc., Seoul, Korea), and two sequences of Korean D. paniculatum were identical. The sequence identified in this study was deposited into the GenBank database (MW740337).

Jin D., Kim J., Sim S., Suh H., & Kim J. (2021). New record of an alien plant, Desmodium paniculatum (Fabaceae), in Korea based on a morphological examination and DNA barcoding. Korean Journal of Plant Taxonomy, 51(2), 133-140.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!