RNAiso Plus kit (Takara, Japan) was adopted to extract total RNA of the Raw 264.7 cells. The RNA was reverse-transcribed into cDNA using PrimeScript RT polymerase (Takara, Japan). mRNA-specific cDNA primers were applied to quantitative PCR. The β-actin gene was used as an internal control. Stem-loop reverse transcriptase-PCR (RT-PCR) for mature miRNAs was performed as described previously. The U6 gene was used as an internal control. The RT-qPCR primer sequences are listed in Supplementary Table 2 . RT-PCR was performed with the SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Bulge-loop miRNA primer sets including one RT primer and a pair of qPCR primers were designed by RiboBio (Guangzhou, China). The results are reported as the average ratios of three independent experiments.
Bulge loop mirna primer set
Manufactured by RiboBio
Sourced in China
The Bulge-Loop miRNA Primer Set is a laboratory tool designed for the detection and analysis of microRNA (miRNA) expression. It consists of a set of primers specifically engineered to target and amplify miRNA sequences that contain bulge-loop structures. The core function of this product is to facilitate the accurate and sensitive quantification of miRNA levels in various biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Abi 7300 real time pcr detection system, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Rnaiso plus kit, by Takara Bio (1 mentions)
Qpcr primers, by RiboBio (1 mentions)
Primescript rt polymerase, by Takara Bio (1 mentions)
Cdna synthesis kit, by Takara Bio (1 mentions)
Mirna first strand cdna synthesis kit, by Sangon (1 mentions)
Mirnas qpcr kit, by Sangon (1 mentions)
Chamq universal sybr qpcr master mix kit, by Vazyme (1 mentions)
Hiscript 2 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Isolator reagent, by Vazyme (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Mirneasy serum plasma kit, by Qiagen (1 mentions)
7 protocols using bulge loop mirna primer set
1
Quantitative Analysis of miRNA
2
Quantitative Analysis of mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured CFs and left atriums using Trizol reagent (Invitrogen, CA), according to the manufacturer's instructions. Total RNA (500 ng for mRNA or 1000 ng for miRNA) from each sample was subjected to reverse transcription according to the instructions of the cDNA Synthesis Kit (TaKaRa, China) and miRNA First Strand cDNA Synthesis Kit (Sangon, China). The expression levels of mRNA and miR‐30c were analysed according to the instructions of the mRNA SYBR qPCR kit (TaKaRa, China) and miRNAs qPCR Kit (Sangon, China) using the ABI‐7300 Real‐Time PCR Detection System (Applied Biosystems, USA). The mRNA primer sequences used in the study are listed in Table 1 . The bulge‐loop™ miRNA Primer Sets (one RT primer and a pair of qPCR primers) specific for miR‐30c and U6 were purchased from RiboBio (Guangzhou, China). The levels of mRNA and miR‐30c were normalized to β‐Actin and U6, respectively. Briefly, the cycle threshold (CT) values of each targeting gene were subtracted from the CT values of the housekeeping gene, referring as ▵ct. Target gene ▵▵ct was determined as ▵ct of target gene minus ▵ct of control. The relative expression levels of all genes were calculated basing on the 2−ΔΔct. All samples were assayed in triplicate.
3
Quantification of miR-497 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells with isolator reagent (Vazyme, China). After measurement of the RNA concentration, cDNAs were generated from reverse transcription with the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, China). The expression level of miR-497 was measured according to the instructions of the ChamQTM Universal SYBR qPCR Master Mix kit (Vazyme, China) using the ABI-7300 Real-Time PCR Detection System (Applied Biosystems, USA). The bulge-loopTM miRNA Primer Sets (one RT primer and a pair of qPCR primers) specific for miR-497 were purchased from RiboBio (Guangzhou, China). The level of miR-497 was normalized to U6. Fold changes were calculated using the 2−ΔΔCt method. Each plate was run in triplicate.
4
Serum microRNA extraction and analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For human serum samples, donors were fasted for food and liquids overnight. 5-mL whole blood was sampled via median cubital vein in the morning. For murine serum samples, before necropsy, the peripheral whole blood was collected from the retro-orbital venous plexus at 500 μL under general anesthesia. The serum were isolated by centrifuging at 3000 rpm 10 min followed by 12000 rpm 10 min at 4 °C. microRNAs from serum were extracted using the miRNeasy Serum/Plasma Kit according to the manufacture’s recommendations (Qiagen, Germany), followed by phenol-chloroform extraction, as described27 (link). cDNA synthesis was performed using reverse transcription primers from the Bulge-loopTM miRNA Primer Sets specific for murine and human miR-21 and RNU6 designed by RiboBio (Guangzhou, China), and PrimeScriptTM RT Reagent Kit (Takara, Japan)42 (link)43 (link).
5
Cartilage Chondrocyte RNA Isolation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cartilage tissues or monolayer-cultured primary chondrocytes using Trizol reagent. Homogenized tissue samples were in 1 mL Trizol reagent per 50–100 mg, and the lysed cells were directly added to 1 mL Trizol reagent in a 3.5-cm diameter dish. For miRNA qPCR analysis, reverse transcription of specific miRNAs was performed with the Bulge-Loop miRNA Primer Set (RiboBio) according to the manufacturer’s instructions. For mRNA analysis, total RNA was reverse transcribed using random primers. The mRNA expression levels were reported relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), whereas miRNA expression levels were reported relative to U6. The primers used in the present study are as follows:
TNF-α forward: 5′-CCTCTCTCTAATCAGCCCTCTG-3′, reverse: 5′-GAGGACCTGGGAGTAGATGAG-3′;
circRNA-MSR forward: 5′-TCCAGTCTGATCCTTTTGTTGG-3′, reverse: 5′-CTGTTTCTTGCTGTAGACGGCT-3′;
hsa_circRNA_103387 forward: 5′-AGTCTTTCCACCTTGGCTCT-3′, reverse: 5′-TGGACAGGGTACTTCTCGTTT-3′;
hsa_circRNA_000598 forward: 5′-GTCCCTTCCCTGTCACTACCT-3′, reverse: 5′-TCTGTTGATGCCGCCTTGG-3′;
hsa_circRNA_101975 forward: 5′-GCCCAAACCAGACCTCACTT-3′, reverse: 5′-TCCTTCTCGGGCTCCTGA-3′; and
GAPDH forward: 5′-GGGAAACTGTGGCGTGAT-3′, reverse: 5′-GAGTGGGTGTCGCTGTTGA-3′.
6
Total RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from SW982 cells using TRIzol reagent (Thermo Fisher, USA). For mRNA analysis, total RNA was reverse transcribed using random primers. For miRNA, quantitative PCR was performed by using the Bulge-Loop miRNA primer set (RiboBio, Guangzhou, China) for specific miRNA transcription. mRNA expression levels were measured relative to GAPDH, whereas miRNA expression levels are reported relative to U6. The primers used in this work are presented in Supplementary Table S2 .
7
Chondrocyte miRNA and mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cartilage tissues or monolayer-cultured primary chondrocytes using TRIzol reagent. For miRNA quantitative PCR analysis, reverse transcription of specific miRNAs was performed with the Bulge-Loop™ miRNA Primer Set (RiboBio) according to the manufacturer’s instructions. For mRNA analysis, total RNA was reverse transcribed using random primers. mRNA expression levels are reported relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), while miRNA expression levels are reported relative to U6. The primers used in the present study were as follows:
COL2 forward: 5′-TGGACGATCACGAAACC-3′, reverse: 5′-GCTGCGGATGCTCTCAATCT-3′;
aggrecan forward: 5′-ACTCTGGGTTTTCGTGACTCT-3′, reverse: 5′-ACACTCAGCGAGTTGTCATGG-3′;
MMP13 forward: 5′-ACTGAGAGGCTCCGAGAAATG-3′, reverse: 5′-GAACCCCGCATCTTGGCTT-3′;
circRNA-CER forward: 5′-CTGGTGCAGTGGAAGCAGAG-3′, reverse: 5′- CGACCCTCCATTGCTCTTCT -3′;
hsa_circRNA_100086 forward: 5′-CCATCCCCTTATTCAGCACAT-3′, reverse: 5′-TCCAAACTTCAGTTTCCTCATCA-3′;
hsa_circRNA_101178 forward: 5′-CTGCGTTGGGAGTCTGGAAG-3′, reverse: 5′- TCACAGGTGAGTGGCAAGTGAG -3′;
GAPDH forward: 5′-GGGAAACTGTGGCGTGAT-3′, reverse: 5′- GAGTGGGTGTCGCTGTTGA -3′;
COL2 forward: 5′-TGGACGATCACGAAACC-3′, reverse: 5′-GCTGCGGATGCTCTCAATCT-3′;
aggrecan forward: 5′-ACTCTGGGTTTTCGTGACTCT-3′, reverse: 5′-ACACTCAGCGAGTTGTCATGG-3′;
MMP13 forward: 5′-ACTGAGAGGCTCCGAGAAATG-3′, reverse: 5′-GAACCCCGCATCTTGGCTT-3′;
circRNA-CER forward: 5′-CTGGTGCAGTGGAAGCAGAG-3′, reverse: 5′- CGACCCTCCATTGCTCTTCT -3′;
hsa_circRNA_100086 forward: 5′-CCATCCCCTTATTCAGCACAT-3′, reverse: 5′-TCCAAACTTCAGTTTCCTCATCA-3′;
hsa_circRNA_101178 forward: 5′-CTGCGTTGGGAGTCTGGAAG-3′, reverse: 5′- TCACAGGTGAGTGGCAAGTGAG -3′;
GAPDH forward: 5′-GGGAAACTGTGGCGTGAT-3′, reverse: 5′- GAGTGGGTGTCGCTGTTGA -3′;
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!